2020, Scienceline Publication

JWPR

Poultry Research

J. World Poult. Res. 10(2S): 203-213, June 14, 2020

Journal of World’^s

Research Paper, PII: S2322455X2000026-10

License:CC BY 4.0

DOI: https://dx.doi.org/10.36380/jwpr.2020.26

Efficacy of Staphylococcus aureus Vaccine in Chicken

Abeer S. El-Maghraby¹*, Shereanaziz² and AbeerMwafy³

¹Central Laboratory for Evaluation of Veterinary Biologics, Abbasia, Cairo, Egypt.

²Veterinary Serum and Vaccine Research Institute (VSVRI), Abbassia, Cairo, Egypt.

³Department of Microbiology, Faculty of Veterinary Medicine, El-Wady El-Gaded University, Cairo, Egypt.

^*Corresponding author’s Email: abeer.maghraby17774@gmail.com; ORCID: 0000-0002-4217-0206

Received: 12 Feb. 2020

Accepted: 23 Mar. 2020

ABSTRACT

Staphylococcus aureus is considered one of the most important pathogens causing septic arthritis in poultry with

significant economic losses. This study aimed to evaluate the efficacy of a locally prepared S. aureus vaccine against

staphylococcal arthritis in poultry. Out of 78 samples collected from infected chickens showing clinical signs bumble

foot, 10 field isolates were detected and confirmed phenotypically by culturing, Gram staining, biochemical and

molecular identification to be S. aureus in prevalence of 12.82%. Molecular identification of clumping factor A

(ClfA) and blaZ genes of S. aureus isolates revealed that the PCR amplification with ClfA and blaZspecific primers

conducted with genomic DNA resulted in products of approximate size 638 bp and 833 bp, respectively.

Phylogenetic tree for S. aureus ClfA virulence gene partial sequences was generated using maximum likelihood,

neighbour joining and maximum parsimony in MEGA6. It showed clear clustring of Egyptian isolated strain (S.

aureus ASM strain) and different S. aureus strains uploaded from GenBank. Sequence identities between the

Egyptian isolated strain (S. aureus ASM strain)and different S. aureus strains uploaded from GenBank revealed

99.5% to 100% homology. Also, there was identity and homology in S. aureusblaZgene nucleotide sequence in the

Egyptian isolated strain (S. aureus ASM strain)and the different S. aureus strains uploaded from GenBank revealed

96.1% to 98.9% homology. Phylogenetic tree for S. aureusblaZβ-lactamases resistant gene partial sequences showed

clear clustring of the Egyptian isolated strain (S. aureus ASM strain)and different S. aureus strains uploaded from

GenBank. The results of humoral immune response revealed that the geometric mean antibody values against locally

prepared S. aureus vaccine measured by indirect hemagglutination test increased from 1^stweek post vaccination

gradually till reached maximum level (322.5) at 6^thweek post boostering. The results showed an increased humoral

antibody production in vaccinated group that was capable of preventing establishment of new S. aureus infection in

vaccinated group compared to control group. The mortality rates in unvaccinated group was higher than that of

vaccinated group were (42.5%, vs. 7.5%) at 1^stand 2^ndweek post challenge (39.1% vs. 5.4%).The protection % in

challenge assay of the prepared S. aureus vaccine was (92.5% and 87.5%) at 1^stand 2^ndweek post challenge

respectively. It could be concluded that the prepeared vaccine was safe, potent and protect birds against S. aureus

infection.

Key words: Blaz, ClfA, PCR, Sequencing, Staphylococcus aureus, Vaccine.

INTRODUCTION

the secretion of an β-lactamases enzyme, encoded by the

blaZ gene in plasmid or chromosome, which inactivates

the antibiotic by hydrolysis of its β-lactam ring, or by the

production of a penicillin binding protein (PBP2A)

encoded by gene mecA (Liu, 2009 ). The need for S.

aureus vaccine was mainly determined by the economic

loss in poultry farming resulting from arthritis in poultry

Fluit et al. (2012). Prophylaxis via prevention of

infection by using antibiotics is of low fee in case of

antibiotic resistant strains, as penetration through the

infected joints no way for theraby of arthritis caused by

S. aureus. Vaccination is the solely way for protection

against staphylococcal arthritis in poultry. The main

objective of this study was to evaluate the efficacy of a

Staphylococcus aureus is regarded as one of the most

prevalent pathogens that can cause great economic losses

in poultry sector. In poultry, S. aureus causes many

clinical syndromes as tenosynovitis, omphalitis, femoral

head necrosis, bumble foot, infected hock and stifle joints

(Sulemian et al., 2013 ). Different antimicrobial agents

such as β-lactamases, macrolides, aminoglycosides and

tetracyclines are extensively used in poultry for treating of

staphylococci and other infections which lead to

development of drug resistant strains of bacteria (Nemati

et al., 2008 ). Resistance to penicillin as developed by

staphylococci is mediated by two mechanisms: either by

To cite this paper: El-Maghraby AS, azizSh and Mwafy A (2020). Efficacy of Staphylococcus aureus Vaccine in Chicken. J. World Poult. Res., 10 (2S): 203-213. DOI:

https://dx.doi.org/10.36380/jwpr.2020.26

203

El-Maghrabyet al., 2020

locally prepared S. aureus vaccine against staphylococcal

arthritis in poultry.

Baird Parker agar media then incubated at 37°C for 24 h.,

according to Quinn et al. (2002).

MATERIALS AND METHODS

Identification of Staphylococcus aureus isolates

Isolated colonies of S. aureus were identified by

classical identification as microscopical examination,

biochemical reactions using API-Staph system (Table 1)

and pathogenicity test according to Quinn et al. (2002),

Taponen et al. (2008 ), López-Malo et al. (2005), El- jakee

et al. (2013), Kateete et al. (2010) and Toply and Wilsons

(1993). Phenotypic characterization of the same isolation

was applied to detect coagulase test according to Quinn et

al. (2002), and hemolysis assay according to Koneman et

al. (1997 ).

Ethical approval

The Institutional Animal Care and Use Committee

(IACUC) has approved animal use protocol used in this

study (Vet. CU. 20022020146).

Samples

collection

and

isolation

Staphylococcus aureus

A total of 78 samples (46 samples from layers farms

and 32 samples from broiler farms) were collected from

private poultry farms in Sharkia, Qalubia, Behira and

Dakahlia governorates, Egypt. The samples taken from

birds having swollen hock joints, wings and foot pads.

These samples were taken under aseptic conditions

according to Jordan et al. (2002). Isolation of S. aureus

was obtained by culturing these samples on tryptic soy

broth (TSB) containing 70 mg/ml NaCl, then culturing

from this broth on blood agar, mannitol salt agar, and

Molecular identification of Staphylococcus aureus

All the identified S. aureus isolates were examined

by PCR for the presence of clumping factor A (ClfA)

virulence associated gene then detected the presence of S.

aureus (blaZ) gene in all field isolates. The primers

sequences and PCR product sizes are shown in table 2.

Table 1. Results of biochemical identification of Staphylococcus aureususing API-Staph system

ADH URE VP GLU MAN SAC MAL FRU MNE LAC TRE XLT MEL NIT PAL RAF XYL MDG

NAG

Test

Result

(ADH) L-arginine, (URE) urea, (VP) VogusProskour, (GLU) D-glucose, (MAN) D-mannitol, (SAC) D-sucrose, (MAL) D-maltose, (FRU) D-fructose,

(MNE) D-mannose, (LAC) D-lactose, (TRE) D-trehalose, (XLT) Xylitol, (MEL) D-melibiose, (NIT) Nitrate potassium, (PAL) L-B-naphtyl phosphate, (RAF)

D-raffinose, (XYL) D-xylose, (MDG) methyl D-glucopyranoside, (NAG) N-acetyl-glucosamine.

Table 2. Primerssequences, target genes, amplicon sizes and cycling conditions.

Amplification (35 cycles)

Amplified

segment

(base pair)

Target

gene

Primary

denaturation

Final

extension

Primers sequences (5'--3')

Reference

Secondary

Annealing Extension

denaturation

F:GCAAAATCCAGCACAACAGGAAACGA

R: CTTGATCTCCAGCCATAATTGGTGG

F:TACAACTGTAATATCGGAGGG

638

833

94˚C

5 min.

94˚C

30 sec.

55˚C

40 sec.

72˚C

45 sec.

72˚C

10 min.

Mason et

al.(2001)

ClfA

blaZ

94˚C

5 min.

94˚C

30 sec.

50˚C

40 sec.

72˚C

50 sec.

72˚C

10 min.

Bagcigilet

al. (2012)

R:CATTACACTCTTGGCGGTTTC

DNA extraction

DNA extraction from samples was performed using

the QIAamp DNA Mini kit (Qiagen, Germany, GmbH)

Oligonucleotide Primer

Primers used were supplied from Metabion

(Germany) are listed in Table 2.

with

modifications

from

the

manufacturer’s

PCR amplification

recommendations. Briefly, 200 µl of the sample

suspension was incubated with 10 µl of proteinase K and

200 µl of lysis buffer at 56^°C for 10 min. After

incubation, 200 µl of 100% ethanol was added to the

lysate. The sample was then washed and centrifuged

following the manufacturer’s recommendations. Nucleic

acid was eluted with 100 µl of elution buffer.

Primers were utilized in a 25- µl reaction containing

12.5 µl of EmeraldAmp Max PCR Master Mix (Takara,

Japan), 1 µl of each primer of 20 pmol concentration, 4.5

µl of water, and 6 µl of DNA template. The reaction was

performed in an applied biosystem 2720 thermal cycler.

204

J. WorldPoult. Res., 10(2S): 203-213, 2020

method and by streaked on blood agar. The colony

Analysis of the PCR products

The products of PCR were separated by

electrophoresis on 1.5% agarose gel (Applichem,

Germany, GmbH) in 1x TBE buffer at room temperature

using gradients of 5V/cm. For gel analysis, 20 µl of the

products was loaded in each gel slot. Generuler 100 bp

ladder (Fermentas, Thermo, Germany) was used to

determine the fragment sizes. The gel was photographed

by a gel documentation system (Alpha Innotech,

Biometra) and the data was analyzed through computer

software.

forming unit was determined by plate counting and

bacterial concentrations was adjusted to contain 1× 109

cells/ml (Raza et al., 2015 ). The S. aureus toxin was

prepared by taking 10 ml of freshly prepared working

solution and incubated into 500 ml of BHI, then incubated

at 37°C for 48 h. The supernatant was taken from broth

culture by filtration. The bacterial culture was inactivated

by adding 0.4% (v/v) formalin (Watson and Davies,

1993 ), at 37°C for 24-48 h with agitation for 24 hrs, Then,

sodium bisulfite was added in a final concentration of 2%

to stop the action of formalin. Samples from inactivated

bacterial culture were tested for complete inactivation by

cultivated on BHI agar media to assure complete

inactivation where no growth was found on any of the

inoculated media after incubation at 37C for 24 h to 7

days of incubation, according to OIE (2014).

Phylogenetic and gene sequence analysis of

ClfAandblaZ genes of Staphylococcus aureus

PCR products were purified using QIAquick PCR

Product extraction kit. (Qiagen, Valencia). Bigdye

Terminator V3.1 cycle sequencing kit (Perkin-Elmer) was

used for the sequence reaction and then it was purified

using Centrisep spin column. DNA sequences were

obtained by Applied Biosystems3130 genetic analyzer

(HITACHI, Japan), a BLAST® analysis (Basic Local

Alignment Search Tool) (Altschul et al., 1990 ) was

initially performed to establish sequence identity to Gen

Bank accessions. The phylogenetic tree was created by

the MegAlign module of Laser gene DNA Star version

12.1 (Thompson et al., 1994) and Phylogenetic analyses

was done using maximum likelihood, neighbor joining

and maximum parsimony in MEGA6 (Tamura et al.,

2013 ).

Determination of the Minimum Lethal Dose

(MLD) of Staphylococcus aureus filtrate in mice

Double fold serial dilutions of the S. aureus filtrate

were prepared in PBS, 0.1 ml of each dilution was

injected into each of three experimental mice weighting

about 25 grams. Mice were kept under observation for 3

days post inoculation and the MLD (which is the

minimum amount of toxin that killed all mice in 3 days)

was determined according to Smith (1975) and Smyth

(1975).

Vaccine formulation according to (Ahmed 2012)

The inactivated S. aureus bacterin and toxoid

vaccine was prepared as an oil emulsion vaccine using

Montanidetm ISA 71 VG adjuvant (SEPPIC, France) in a

ratio of 71 adjuvant: 29 antigen. Merthiolate (Thiomersal)

was used in a final concentration of 1: 10,000 as a

preservative. The dose of the prepared vaccine was 0.5ml

contain 1×109 CFU and MLD50 of toxoid.

Vaccination and challenge test

Vaccine preparation

The vaccine was prepared according to the methods

described by Giraudo et al. (1997), Ahmad and

Muhammad (2008) and Raza et al. (2015). From the

complete identified isolated Egyptian strain (S. aureus

ASM strain), 10 ml from the freshly preperaed culture

was streaked on brain-heart infusion agar and incubated at

37°C for 18 h Then, the strain was separately subcultured

in brain-heart infusion at 37°C for 24 h.

Preparation of S. aureusbacterin in liquid medium:

A culture of well identified strain was prepared from

single colony which was scaled up to one TSB medium.

Also preparation of S. aureusbacterin on solid medium by

cultivation of single colony on BHI agar or TS agar then

incubated at 37°C for 24 h The bacterial suspension was

centrifuged at (3000 rpm at 4°C for 30 min) to pellet the

bacterial cells, after that the bacterial pellets washed and

resuspended in 0.15 mol/l PBS (pH 7.2). The culture

suspension was examined for purity through Gram’s stain

Quality control of the prepared Staphylococcus

aureus vaccine

The prepared S. aureus inactivated oil emulsion

vaccine was tested for sterility test, safety test, complete

inactivation and potency according to the Standard

International Protocols as described by the OIE (2017).

Experimental design

One hundred and sixty, 1-day-old SPF chickens

were obtained from Nile- SPF farm, KomOshim project,

El-Fayoum Governorate, Egypt. The chickens were

housed in SPF isolator units in specific CLEVB animal

care building with water and feed provided ad-libitum. At

205

El-Maghrabyet al., 2020

3 weeks of age, blood samples were collected for

abscess or bumble foot, ten locally field isolates were

detected and confirmed phenotypically by culturing,

Gram staining, biochemical and molecular identification

to be S. aureus in prevalence of (12.82%). Gram’s

staining revealed that the colonies morphology of S.

aureus were small to medium sized and golden yellow on

BHI agar, while the colonies appeared surrounded by a

double zone of beta haemolysis on blood agar plates, on

mannitol salt agar, they were yellow color surrounded by

yellow halo with yellow colored medium the colonies

were typically black smooth with entire margin on Baird

Parker agar media.

serological examination to insure their freedom from

maternally derived antibodies against S. aureus, 3 weeks

old SPF broiler chickens were divided into 3 groups,

chickens of group (1) of 80 birds injected S/C with 0.5ml

of previously prepared oil adjuvanted S. aureus vaccine in

the middle part of the neck two times with 3 weeks

intervals, the groups 2 and 3 ,each group consisted of 40

birds, as control positive and negative groups wereleft

unvaccinated.

Serum samples were obtained regularly from

vaccinated and unvaccinated groups before immunization,

weekly for 3 weeks after the primary vaccination and

every week post boostering for 6 weeks, and stored at -20

°C untill used.

Phenotypic characterization of some virulence

factors as haemolysin production assay and coagulase

production.

Challenge test

All ten S. aureus isolates were coagulase positive

and produce bata hemolysis.

Birds of groups 1 and 2 were challenged 4 weeks

after the booster dose by oral administration of 1ml of

broth culture containing 1×109 CFU of reference S.

aureus virulent strain obtained from Veterinary Serum

and Vaccine Research Institute (VSVRI), Abassia. The

inoculated chickens were observed for one month. The

degree of protection was assessed according to the

severity of the clinical signs, the mortality and the

recovery of the challenge organisms from fecal samples

were assayed according to Paiva et al. (2009).

Molecular identifiction of ClfA and blaZ genes of

Staphylococcus aureus isolates

The PCR amplification with ClfA specific

primers was conducted with genomic DNA, which

resulted in a product of approximate size 638bp (Figure

1).ClfA gene was found in all ten (100 %) S. aureus

isolates. The PCR amplification with blaZ gene specific

primers was conducted with genomic DNA, resulted in a

product of approximate size 833 bp (Figure 2). BlaZ gene

was present in ten (100 %) S. aureus isolates. Sequence

identities between the isolated Egyptian strain (S. aureus

ASM strain)and different S. aureus strains uploaded from

GenBank revealed that 99.5% to 100% homology.

Sequence identities between the Egyptian isolated strain

(S. aureus ASM strain)and different S. aureus strains

uploaded from GenBank revealed that 96.1% to 98.9%.

Detection of the shedding of Staphylococcus

aureus in fecal samples

One week after the challenge and for 4 weeks,

cloacal swabs were collected from each of the infected as

well as control groups and examined bacteriologically for

the presence of S. aureus weekly during one month after

challenge according to Ahmed (2012) and Raza et al.

(2015 ).

Suspected

colonies

were

identified

morphologically and biochemically.

Quality control of the preperaed Staphylococcus

aureus vaccine

Antibody titers

Indirect haemagglutination test for measuring

antibody titers in vaccinated chickens were done

according to Rahman et al. (2005).

assured that the locally prepared vaccine free from

any bacterial (aerobic or anaerobic contaminants) or

fungul contamination and safe as there was no local

reaction found in all injected chickens.

RESULTS

Antibody titers in vaccinated chickens

Isolation and identification of Staphylococcus

aureus field isolates

The results of humoral immune response revealed

that the geometric mean antibody titers against S. aureus

values of both groups as shown in table 3. The GMT

antibody titer was (16) in the 1^stweek post vaccination,

Out of a total number of 78 samples were collected

from infected chicken showing clinical signs of planter

206

J. WorldPoult. Res., 10(2S): 203-213, 2020

and increase gradually at the 2^ndweek (20.16), till reach

to maximum level at 6^thweek was (322.5) as shown in

Table 3.

(92.5%). Protection or survival (%) till 15 day post

challenge (0%) in control group and (87.5%) in

vaccinated group as shown in table 4. The challenge

protection assay showed

a considerable protective

immune response of prepared S. aureus vaccine.

Challenge test

The vaccine showed a considerable survival rate in

challenged vaccinated group compared to control group.

The mortality rates and survival percentages in groups

control and vaccinated are summarized in table 4, the NO.

of dead chickens in the 1^stweek post challenge in the

control and vaccinted group were 17 (42.5%) and 3

(7.5%), respectively. The mortality rate in the 2^ndweek in

the control group 9 (39.1%) and vaccinated group 2

(5.4%). Protection or survival (%) till day 7 post

challenge (20%) in control group and vaccinated group

Detection of the shedding of Staphylococcus

aureus in fecal samples

The results in Table 5 showed that the fecal

shedding of chickens challenged with virulent S. aureus

strain in group 1 vaccinated with locally prepared oil

adjuvantedS. aureus vaccine was 10.8%, 8.5% and 0% in

1^st, 2^nd, 3^rdweek post challenge, respectively. Shedding

disappeared by the 4^thweek post challenge.

Table 3.Geometricmean of Staphylococcus aureus antibody titers in sera of chickens vaccinated with locally prepared oil

adjuvanted S. aureus vaccine and non-vaccinated groups measured by indirect haemagglutination test.

Time intervals

Geometric mean anti-S. aureus antibody titers

Pre-vaccination

20.16

40.3

50.79

161

256

322.5

1^stwpv

2^ndwpv

3^rdwpv

1^stwpb

2^ndwpb

3^rdwpb

4^thwpb

5^thwpb

6^thwpb

wpv: week post-vaccination; wpb: week post-boostering

Table 4.Comparison ofmortality ratein chicken groupsunvaccinated and vaccinated with the locally prepared oil

adjuvantedStaphylococcus aureus vaccine post challenge with virulent reference Staphylococcus aureus strain

No. of dead birds

Mortality rate

1^st

wpc

4^th

wpc

1^st

week

2^nd

week

3^rd

week

Groups

2^ndwpc

3^rdwpc

Total

Total birds

Vaccinated

7.5%

5.4%

12.5%

92.5%

Unvaccinated

42.5%

39.1%

57.1%

wpv: week post- challenge

Table 5.Comparison of rate offecalshedding in chicken groupsunvaccinated and vaccinated with the locally prepared oil

adjuvantedStaphylococcus aureus vaccinepostchalleng with virulent reference Staphylococcus aureus strain

No. of birds positive for S. aureus isolation/ total No. of living birds

Groups

1^stwpc

2^ndwpc

3^rdwpc

4^thwpc

10.8%

(4/37)

8.5%

(3/35)

(0/35)

Vaccinated

47.8%

(11/23)

57.1%

(8/14)

33.3%

(2/6)

33.3%

(1/3)

Unvaccinated

wpv: week post- challenge

207

El-Maghrabyet al., 2020

Figure 1. Agarose gel showing PCR amplified product of 638 bp of clumping factor A (ClfA) virulence gene for Staphylococcus aureus,

lanes (1) to (10): samples positive for ClfA gene, Lane (Pos.): positive control, Lane (Neg.): Negative control, Lane (L): MW 100bp ladder

(DNA marker).

Figure 2. Agarose gel showing PCR amplified product of 833 bp of β-lactamase resistant (Blaz) gene for Staphylococcus

aureus, lanes (1) to (10): samples positive for Blaz gene, lane (pos.): positive control, lane (Neg.): Negative control, Lane (L):

MW 100bp ladder (DNA marker).

Figure 3. Phylogenetic tree for Staphylococcus aureusclumping factor A (ClfA) virulence gene partial nucleotide sequences

that was generated using maximum likelihood, neighbor joining and maximum parsimony in MEGA6. It shows clear

clustering of the Egyptian isolated strain (S. aureus ASM strain) and different S. aureus strains uploaded from GenBank.

208

J. WorldPoult. Res., 10(2S): 203-213, 2020

Figure 4. Phylogenetic tree for Staphylococcus aureusβ-lactamase (Blaz) resistant gene partial nucleotide sequences that was

generated using maximum likelihood, neighbor joining and maximum parsimony in MEGA6. It showed clearclustering of the

Egyptian isolated strain (S. aureus ASM strain) and different S. aureus strains uploaded from GenBank.

Figure 5. Nucleotide sequence distance of Staphylococcus aureusclumping factor A (ClfA) virulence gene between the

Egyptian isolated strain (S. aureus ASM strain) and different S. aureus strains uploaded from GenBank

209

El-Maghrabyet al., 2020

Figure 6. Nucleotide sequence distance of Staphylococcus aureusβ-lactamase (Blaz) resistant gene between the Egyptian

isolated strain (S. aureus ASM strain) and different S. aureus strains uploaded from GenBank

production. All ten S. aureus isolates were coagulase

positive and produce bata hemolysis, these two factors are

important in phagocytosis and infection due to toxins

production respectively (Bhanderi et al., 2009 and

Cariolato et al., 2008 ).

DISCUSSION

Among the most important diseases of poultry, S. aureus

infection, also called bumble foot, is a common bacterial

disease of commercial broilers and layers. It causes

significant economic losses through mortality (0-15%)

and reduce production performance of birds. Out of a total

number of 78 samples were collected from infected

chicken showing clinical signs of planter abscess or

bumble foot, ten locally field isolates were detected and

confirmed phenotypically by culturing, Gram staining,

biochemical and molecular identification to be S. aureus

in prevalence of (12.82%), this findings agree with Marek

et al. (2016) (15.89%) and disagree with Mamzaet al.

(2010) (52.5%), (Suleiman et al., 2013 ) (54%), Abd El-

Tawab et al. (2017) (66%), Rasheed (2011) (50.98%).

The colonies morphology of S. aureus were small to

medium sized and golden yellow on BHI agar, while the

colonies appeared surrounded by a double zone of beta

haemolysis on blood agar plates, on mannitol salt agar,

they were yellow color surrounded by yellow halo with

yellow colored medium the colonies were typically black

smooth with entire margin on Baird Parker agar media.

For the biochemical results, strains revealed that all were

identified as S. aureus as shown in table 2. This finding

was in accordance with the findings of Topley and Wilson

(1990), Selim et al. (1984) and Paul et al. (2014).

Molecular identifiction of ClfA and blaZ genes of

S. aureus isolates revealed that the PCR amplification

with ClfA specific primers was conducted with genomic

DNA, which resulted in a product of approximate size

638bp. clumping factor A (ClfA) gene was found in all ten

(100 %) S. aureus isolates these results agree with Nemati

et al., (2009) (100%), Erfan and Marouf (2015) (100%)

and disagree with Mohamed A. Lebdah et al., (2015)

(20%). S. aureus expresses several different proteins

including clumping factors A (ClfA) that play an

important role in the ability of S. aureus to cause disease

Perkins et al., (2001) and Walsh et al., (2008). Clumping

factor A (ClfA) is a microbial surface protein that

promotes S. aureus binding to fibrinogen, and is

associated with septic arthritis and infective endocarditis

Elkhatib et al., (2015). The PCR amplification with blaZ

gene specific primers was conducted with genomic DNA,

resulted in a product of approximate size 833 bp.blaZ

gene was present in ten (100 %) S. aureus isolates these

finding nearly agree with Bakheet et al. (2018) (74%) and

disagree with Ganugula Mohana Sheela (2017) (57.69%).

Phylogenetic and partial gene sequence analysis of

ClfAandblaZ genes of S. aureus that was generated using

maximum likelihood, neighbour joining and maximum

Phenotypic characterization of some virulence

factors as haemolysin production assay and coagulase

210

J. WorldPoult. Res., 10(2S): 203-213, 2020

parsimony in MEGA6, showed clear clustering of isolated

Quality control of the prepared S. aureus vaccine

assured that the locally prepared vaccine free from any

bacterial (aerobic or anaerobic contaminants) or fungal

contamination and safe as there was no local reaction

found in all injected chickens.

Egyptian strain (S. aureus ASM strain) and different S.

aureus strains uploaded from GenBank. Sequence

distance of S. aureus ClfA virulence gene (Figure 3) was

created by the MegAlign module of Laser gene DNA

Star. Sequence identities between the isolated Egyptian

strain (S. aureus ASM strain) and different S. aureus

strains uploaded from GenBank (Figure 5) revealed that

99.5% to 100% homology. When analyzing nucleotide

sequence of ClfA gene of the Egyptian isolated strain (S.

aureus ASM strain) in the current study showed 100%

nucleotide identity with locally isolated Egyptian S.

aureus strain SA.EGY1 recovered by Erfan and Marouf

(2018) (accession No. MG821495.1). The Egyptian

isolated strain (S. aureus ASM strain) showed also 100%

identity with the indianS. aureus strain R1/Bov/2015 by

Vaidya et al., (2016) (GenBank accession No.

KX181853.1). Also showed 99.8% identity with the

American S. aureus strain C2 by Murphy et al., (2011)

(GenBank accession No. HQ424270.1), and showed

99.7% identity with the American S. aureus strain

FFP221 by Murphy et al. (2011) (GenBank accession No.

HQ424283.1), American S. aureus strain 57/92 by

Murphy et al. (2011) (GenBank accession No.

HQ424256.1) and American S. aureus strain CA-548

(GenBank accession No. HQ424254.1). Concerning S.

aureus blaZ gene nucleotide sequence analysis revealed

great homology and identity between the Egyptian

isolated strain (S. aureus ASM strain) and the different S.

aureus strains uploaded from GenBank. Phylogenetic tree

for S. aureus blaZβ-lactamase resistant gene (Figure 4)

partial sequences showed clear clustering of the Egyptian

isolated strain (S. aureus ASM strain) and different S.

aureus strains uploaded from GenBank. Figure 6 shows

that sequence distance of S. aureus blaZantibiotic

resistant gene was created by the MegAlign module of

Laser gene DNA Star. Sequence identities between the

Egyptian isolated strain (S. aureus ASM strain) and

different S. aureus strains uploaded from GenBank

revealed that 96.1% to 98.9%. When analyzing nucleotide

sequence of blaZ B-lactamase resistant gene of the

Egyptian isolated strain (S. aureus ASM strain) in the

current study it showed 98.9% identity with the Ireland S.

aureus MOK042 strain recovered by Keane and

Cormican 2018), (GenBank accession No. CP029627.1),

the American S. aureus strain AR_0470 recovered by

Benahmed et al., (2018) (GenBank accession No.

CP029653.1) and the German S. aureus isolate 6_LA_232

recoverd by Schleimer et al. (2018) (GenBank accession

No. LT992465.1).

The results of humoral immune response revealed

that the geometric mean antibody titers against S. aureus

values of both groups as shown in table 3. The GMT

antibody titer was (16) in the 1^stweek post vaccination,

and increase gradually at the 2^ndweek (20.16), till reach

to maximum level at 6^thweek was (322.5) as shown in

Table 3. These finding agree with (Raza et al., 2015 ). The

vaccine showed a considerable survival rate in challenged

vaccinated group compared to that of control group. The

mortality rates and survival percentages in groups control

and vaccinated are summarized in table 4, the NO. of

dead chickens in the 1^stweek post challenge in the control

and vaccinated group were 17 (42.5%) and 3 (7.5%),

respectively. The mortality rate in the 2^ndweek in the

control group 9 (39.1%) and vaccinated group 2 (5.4%).

Protection or survival (%) till day 7 post challenge (20%)

in control group and vaccinated group (92.5%). Protection

or survival (%) till 15 day post challenge (0%) in control

group and (87.5%) in vaccinated group as shown in Table

4. The challenge protection assay showed a considerable

protective immune response of prepared S. aureus

vaccine. The findings were in agreement with Giraudo et

al. (1997) and Ahmad and Muhammad (2008) with

significantly higher survival percentage in vaccinated

group compared to that of in control group. The results of

challenge protection assay suggested that vaccine is

capable of eliciting protective immune response and

prevent further new infections of S. aureus. Fecal

shedding post challenge was also significantly reduced in

the vaccinated chickens compared with those in the

unvaccinated suggesting that the vaccine could be

effective against S. aureus. Table 5 showed that the fecal

shedding of chickens challenged with virulent S. aureus

strain in group 1 vaccinated with locally prepared oil

adjuvantedS. aureus vaccine was (10.8%, 8.5% and 0%)

in 1^st, 2^nd, 3^rdweek post challenge, respectively. Shedding

disappeared by the 4^thweek post challenge. These results

agree with previous studies showed that bacterin-toxoid

prevent development of new S. aureus infection probably

due to increased opsonization, increased phagocytic

activity of polymorphonuclear cells as a result of

augmented specific IgG antibodies against S.aureus

(Pellegrino et al., 2010 and Raza et al., 2015 ). From this

study it could be concluded that the locally prepared

vaccine was safe, potent and could be recommended to be

used in poultry farms to prevent S. aureus infections in

chicken.

211

El-Maghrabyet al., 2020

El-Jakee JK, Noha E. Aref, AlaaGomaa , Mahmoud D El-Hariri, Hussein

DECLARATIONS

Acknowledgments

This study was supported by the Central Laboratory

for Evaluation of Veterinary Biologics (CLEVB),

Abbasia, Cairo and Veterinary Serum and Vaccine

Research Institute (VSVRI), Abbasia, Cairo, Egypt.

M Galal, Sherif A Omar, Ahmed Samir (2013). Emerging of

coagulase negative staphylococci as a cause of mastitis in dairy

animals: An Environmental hazard.International Journal of

Veterinary Science and

Medicine.

1: 74–78.

DOI:

https://doi.org/10.1016/j.ijvsm.2013.05.006

Elkhatib WF, Hair PS, Nyalwidhe JO and Cunnion KM (2015). New

potential role of serum apolipoprotein E mediated by its binding to

clumping factor A during Staphylococcus aureus invasive infections

to humans. Journal Medical Microbiolgy, 64: 335-343. DOI:

https://doi.org/ 10.1099/jmm.0.000010

Competing interests

Erfan AM and Marouf SH (2015). Biofilm-producing Staphylococcus

aureus screening in poultry farms and abattoirs. Journal of Animal

and Veterinary Advances, 14 (10): 273-279. Available at:

https://www.researchgate.net/publication/301849264

The authors have declared that no competing

interest exists.

Authors' contribution

Erfan AM and Marouf SH (2018). Molecular characterization of bacterial

respiratory disease in poultry, regarding the effect of cinnamon oil

submitted reference laboratory for veterinary quality control on

poultry production, Animal health research institute, Nadi El-

seidstreet, Dokki, Giza 12618, Egypt.

Abeer El-Maghraby designed the concept of the

article, wrote the manuscript. SherenAzez and

AbeerMwafy prepared the vaccine. AbeerMwafy revised

the manuscript. All authors designed and performed the

experiments and reviewed and approved the manuscript.

Fluit AC (2012). Livestock- associated Staphylococcus aureus.

Clinical.Microbiology

and

Infection,18:

735–744.DOI:

https://doi.org/10.1111/j.1469-0691.2012.03846.x

REFERENCES

GanugulaMohana Sheela (2017). Study of pathogenic factors of

Staphylococcus aureus from clinical cases of livestock and poultry.

PhD. Thesis, Department of Biotechnology, Vignan’s Foundation

for Science Technology and Research Univerisity, Vadlamudi

Abd El-Tawab A, Fatma I Hofy, Sahar R Mohamed and Sohila H Amin

(2017). Characterization of methicillin resistance Staphylococcus

aureus isolated from chicken and human. Benha University Medical

Journal, 32 (1): 132- 137.Available at: http://www.bvmj.bu.edu.eg

Guntur,

Andhra

Pradesh,

India.Available

at:

https://vignan.ac.in/pdf/Mohana%20Sheela.pdf

Giraudo JA, Calzolari A, Rampone H, Rampone A, Giraudo AT, Bogni

C, Larriestra A and Nagel R (1997). Field trials of a vaccine against

bovine mastitis. 1. Evaluation in heifers. Dairy Science, 80: 845-

Ahmad T and Muhammad G (2008). Evaluation of Staphylococcus

aureus and Streptococcus agalactiaealuminum hydroxide

adjuvanted mastitis vaccine in rabbits. Pakistan Journal Agricultural

Science, 45: 353-361. Available at: http://agris.fao.org/agris-

search/search.do?recordID=PK2009000420

853.DOI:http://10.3168

/jds.

S0022-0302(97)76006-

5.DOI: https://doi.org/10.3168/jds.S0022-0302(97)76006-5

Jordan F, Pattison M, Alexander D, Faragher T (2002). Poultry

diseases.5^thediton. London: W. B. Saunders. p. 163. Available

Ahmed Mohamed Osman Abd El-Karim (2012). Studies on preparation,

standardization and evaluation of Staphylococcus aureus vaccine in

poultry.Ph.D. thesis.Department of Microbiology, Faculty of

Veterinary Medicine, Cairo University.

at:www.chegg.com

› textbooks › poultry-diseases-5th-edition-

9780702.

Kateete DP, Kimani CN, Katabazi FA, Okeng A, Okee MS, Nanteza A,

Joloba ML and Najjuka FC (2010).Identification of Staph.aureus:

DNase and mannitol salt agar improve the efficiency of the tube

coagulase test. Annals of .Clinical. Microbiology and

Altschul SF, Gish W, Miller W, Myers EW and Lipmanl DJ (1990). Basic

local alignment search tool. Journal Molecular Biology, 215: 403-

410. DOI: https://doi.org /10.1016/S0022-2836(05)80360-2

Bagcigil AB, Taponen S, Koort J, Bengtsson B, Myllyniemi A and

Pyörälä S(2012). Genetic basis of penicillin resistance of S. aureus

isolated in bovine mastitis.ActaVeterinariaScandinavica, 54: 69.

DOI: https://doi.org /10.1186/1751-0147-54-69

Antimicrobials,

https://www.ann.clinicrob.com/content/9/1/23

23.Available

at:

Keane OM and Cormican P (2018). Complete genome sequence of ST71

Staphylococcus aureus isolates from bovine milk Submitted (24-

MAY-2018) Animal & Bioscience, Teagasc, Grange, Dunsany, Co

Meath N/A, Ireland.

BakheetAml A, Amen Omar Habaty, Sayed HAL, DarwishSamah F

(2018). Prevalence of Staphylococcus aureusin broiler chickens with

special reference to beta-lactam resistance genes in the isolated

strains. Alexandria Journal for Veterinary Sciences, 57 (2): 25-33.

Koneman EW, Allen SD, Janda WM, Schreckenberger PC and WinnJr

WC (1997). Color Atlas and Textbook of Diagnostic Microbiology,

JB Lippincott, Philadelphia, p.1395

Benahmed FH, Lutgring JD, Yoo B, Machado M, Brown A, McAllister

G, Perry A, Halpin AL, VavikolanuK, Ott S, Zhao X, Tallon LJ,

Sadzewicz L, Aluvathingal J, Nadendla S, Voskania-kordi A,

Simonyan V, Patel J and Shawar RM (2018). Direct Submission

Journal Submitted (24-MAY-2018), Center for Devices and

Radiological Health, US Food and Drug Administration, 10903 New

Hampshire Avenue, Silver Spring, MD 20993-0002, USA.

Liu, GY (2009). Molecular Pathogenesis of Staphylococcus aureus

.Infection.

10.1203/PDR.0b013e31819dc44d

Pediatric

Research.,

65:

71-77.DOI:

López-Malo A, Vigil E, Palou ME and Parish PM (2005). In: Davidson,

Methods for Activity Assay and Evaluation of Results. Davidson

P.M, Sofos N.J, Branene A.L, editors. Boca Raton, FL, USA:

Antimicrobials in Food, Taylor and Francis Group; pp. 659–680.

DOI: http://dx.doi.org /10.1201/9781420028737.ch21

Bhanderi BB, Roy A, Yadav MM and Joshi CG (2009). PCR based

detection of virulence associated genes of Staphylococcus aureus

from clinical and subclinical bovine mastitis. Royal Veterirnary

Mamza SA, Egwu GO and Mshelia GD (2010). Antibiotic susceptibility

patterns of beta-lactamase-producing Escherichia coli and

Staphylococcus aureus isolated from chickens in Maiduguri (Arid

zone), Nigeria Veterinary Archive, 80: 283-297. Available at:

www.researchgate.net › publication › 228494706_

Journal

India,

5(1/2),

20-26.

Available

at:

https://www.researchgate.net/publication/40904878

Cariolato D, Andrighetto C and Lombardi A (2008). Occurrence of

virulence factors and antibiotic resistance in Enterococcus

faecalisand Enterococcus faecium collected from dairy and human

samples in North Italy. Food Control, 19: 886–892.DOI:

https://doi.org/10.1016/j.foodcont.2007.08.019

Marek A, Stepień-Pyśniak D, Pyzik E, Adaszek Ł, Wilczyński J and

Winiarczyk

(2016). Occurrence and characterization of

Staphylococcus bacteria isolated from poultry in Western Poland.

212

J. WorldPoult. Res., 10(2S): 203-213, 2020

Berl Munch TierarztlWochenschr, 129 (3-4): 147-52.DOI:

http://dx.doi.org/10.2376/0005-9366-129-147

Rasheed BY (2011).Isolation and identification of bacteria causing

arthritis in chickens. Iraqi Journal of Veterinary Sciences, 25: 93-

95.DOI: http://dx.doi.org/10.33899/ijvs.2011.5651

Mason WJ, Blevins JS, Beenken K, Wibowo N, Ojha N and Smeltzer MS

(2001).Multiplex PCR Protocol for the Diagnosis of Staphylococcal

Infection. Journal of Clinical Microbiology, 39 (9): 3332–3338.DOI:

http://dx.doi.org/10.1128/JCM.39.9.3332 –3338.2001

Raza A, Muhammad G, Rahman SU, Rashid I, Hanif K, Atta A and

Sharif S (2015). Evaluation of humoral immunity and protective

efficacy of biofilm producing Staphylococcus aureusbacterin-toxoid

prepared from a bovine mastitis isolate in rabbit. International

Journal of Veterinary Resarch, 16 (1): 69-74. Available at:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4789243/pdf/ijvr-

16-069

Mohamed A. Lebdah, Fatma M. Youssef and Ezz-Eldin (2015).A

bacterial leg infections in broiler chickens. Zagazig Veterinary

Journal,

(3):

179-188.

DOI:

http://dx.doi.org/10.21608/zvjz.2015.28455

Schleimer N, Van Alen S and Kaspar U (2018).University Hospital

Munster, Institute of Medical Microbiology, Muenster, 48149,

Germany.

Murphy E, Lin SL, Nunez L, Andrew L, Fink PS, Dilts DA, Hoiseth SK,

Jansen KU and Anderson AS (2011). Challenges for the evaluation

of Staphylococcus aureus protein based vaccines: Monitoring

antigenic diversity Submitted (19-OCT-2010) Pfizer Vaccine

Research, 401 N. Middletown Road, Pearl River, NY 10965, USA.

Selim SA, Osman KM, Ismail M, Mohamed SM and Margan SD

(1984).Virulence of staphylococci to mice and its relation to

lysozyme production and coagulase activity activity. Archive of

ExperimentelleVeterinarmedizin, 38 (5) : 692- 696. Available at:

https://www.ncbi.nlm.nih.gov/pubmed/6529329

Nemati M, Hermans K, Lipinska U, Denis O, Deplano A, Struelens M

(2008). Antimicrobial resistance of old and recent Staphylococcus

aureus isolates from poultry: first detection of livestock-associated

methicillin-resistant strain ST398. Antimicrobial Agents and

Smith LDS (1975). The Pathogenic Anaerobic Bacteria., 2^ndedition.

Chemotherapy,52

(10):

3817-3819.DOI:

Springfield, Illinois: Charles C. Thomas.

http://dx.doi.org/10.1128/AAC.00613-08

Smyth CJ (1975). The identification and purification of multiple forms of

NematiM, Hermans K, LucADevriese, DominiekMaes and Freddy

Haesebrouck (2009). Screening of genes encoding adhesion factors

and biofilm formation in Staphylococcus aureus isolates from

theta-haemolysin (theta toxin) of C. perfringens type A. Journal of

General

Microbiology,

87:

219–238.

DOI:

http://dx.doi.org /10.1099/00221287-87-2-219

poultry.

http://dx.doi.org/10.1080/03079450903349212.

OIE(2014). Avian Influenza,Manual of Diagnostic Tests and Vaccines for

Terrestrial Animals. OIE, Paris,

France.Avilableat:https://www.oie.int/doc/ged/D13850

Avian

Pathology,

(6):

513-517.DOI:

Suleiman A, Zaria LT, Grema HA and AhmaduP(2013). Antimicrobial

resistant coagulase positive Staphylococcus aureus from chickens in

Maiduguri, Nigeria.Sokoto. Journal of Veterinay Science, 11(1): 51-

55.DOI:https://dx.doi.org/104134/skojvs.v11i1.8

Tamura K., Stecher G, Peterson D, Filipski A and Kumar S (2013).

MEGA6: molecular evolutionary genetics analysis version 6.0. Mol.

OIE (2017). Terrestrial Animal Health Code. Chapter: 6.5. Prevention,

Detection and Control of S. aureus in poultry.Avilable at:

https://www.oie.int/fileadmin/Home/eng/InternationaStandard_Setti

ng/docs/pdf/A_TAHSC_Sept_2017

Biol.

Evol.,

30:

2725–

2729.DOI:http://dx.doi.org /10.1093/molbev/mst197

Taponen S, Bjorkroth J and Pyorala S (2008). Coagulase-negative

staphylococci isolated from bovine extramammary sites and

intramammary infections in a single dairy herd. Journal of Dairy

Paiva JB, Penha FRAC, Arguello YMS, Silva MD, Gardin Y, Resende F,

Berchieri Junior A, and Sesti L. (2009). Efficacy of several

Salmonella vaccination programs against experimental challenge

with Salmonella gallinarumin commercial browen layer and broiler

breeder hens. Brazil Journal of Poultry Science, 11(1): 65−72.

Avilableat:http://www.scielo.br/pdf/rbca/v11n1/v11n1a10

Research,

75:422–

429.DOI:http://dx.doi.org /10.1017/S0022029908003312

Thompson JD, Higgins DG and Gibson TJ (1994). CLUSTAL W:

improving the sensitivity of progressive multiple

Paul DP, Isore SN, Joardar SK, Mukhopadhayay and Ganguly S

(2014).Pathogenicity test of Staphylococcus sp. by experimental

animal inoculation technique. Indian Journal of Comparative

Microbiology, Immunology and Infectious Diseases, 35 (2): 95-

96.DOI: http://dx.doi.org /10.5958/0974-0147.2014.00013.0

sequence alignment through sequence weighting, position-specific

gap penalties and weight matrix choice. Nucleic Acids Research,

22(22): 4673-4680.DOI:http://dx.doi.org /10.1093/nar/22.22.4673

Topley CC and Wilson (1990).Principles of Bacteriology, Virology and

Immunology.8^thedition. Vol. 3.Edward Arnold Pub. Ltd., 216: 490-

503

Pellegrino M, Giraudo J, Raspanti C, Odierno L and Bogni

Topley CC and Wilson (1993).Microbiology and Microbial infection.9^th

edition. Vol3.WilliamJ.Hasuler Jr.

(2010).Efficacy of immunization against bovinemastitis using a

Staphylococcus aureus avirulent mutantvaccine. Vaccine, 28: 4523-

4528.

DOI:http://

10.1016/j.vaccine.DOI:

Vaidya R, Mukherjee R, Chaudhuri P, Chakravarti S, De UK, Dimri U,

Kar D, Thakur N, Chandel S and Vikas K (2016). Molecular

characterization of Staphylococcus isolates from India Submitted

http://dx.doi.org/10.1016/j.vaccine.2010.04.056.

Perkins S, Walsh EJ, Deivanayagam CC, Narayana SV, Foster TJ and

Hook M (2001). Structural organization of the fibrinogen-binding

region of the clumping factor B MSCRAMM of Staphylococcus

(04-MAY-2016)

Veterinary

Medicine,

ICAR-IVRI,

Izatnagar,Bareilly, Uttar Pradesh 243122, India.

aureus.Journal

Biological.Chemistery,

276:

44721-

Walsh EJ, Miajlovic H, Gorkun OV, and Foster TJ(2008). Identification

of the Staphylococcus aureus MSCRAMM clumping factor B (ClfB)

binding site in the αC-domain of human fibrinogen. Microbiology,

154: 550-558.DOI:http://dx.doi.org/10.1099/mic.0.2007/010868-0

44728.DOI:http://dx.doi.org /10.1074/jbc.M106741200

Quinn PJ, Markey BK, Carter ME, Donelly WJ and Leonard FC (2002).

Veterinary Microbiology and Microbial Disease. 1^stPublished A

Black

well

Science

Company.Available

at:

Watson DL and Davies HI(1993). Influence of adjuvants on the immune

https://www.wiley.com/en-

eg/Veterinary+Microbiology+and+Microbial+Disease%2C+2nd+Ed

ition-

response of sheep to a novel Staphylococcus aureus vaccine.

Veterinary

Microbiology,

34:

139-

153.DOI:http://dx.doi.org/10.1016/0378-1135(93)901687.

Rahman SU, Athar M, Shakoor A, Muhammad G and Butt AA (2005).

Standardization of indirect haemagglutination test for titration of

antibody against Staphylococcus aureus, Streptococcus agalactiae

and Escherichia coli isolated from bubaline mastitis. Internationl

Journal of Agriculture and Biology, 7: 441- 444.

213