2020, Scienceline Publication

JWPR

Poultry Research

J. World Poult. Res. 10(2S): 214-222, June 14, 2020

Journal of World’^s

Research Paper, PII: S2322455X2000027-10

License: CC BY 4.0

DOI: https://dx.doi.org/10.36380/jwpr.2020.27

Association of Antiseptic Resistance Gene (qacEΔ1) with Class 1

Integrons in Salmonella Isolated from Broiler Chickens

Naglaa M. Ali and Fatma M. Mohamed*

Poultry Diseases, Assiut Regional Laboratory, Animal Health Research Institute, Agricultural Research Center (ARC), Egypt.

^*Corresponding author’s Email: fmmi@yahoo.com; ORCID: 0000-0003-3393-4638

Received: 12 Feb. 2020

Accepted: 18 Mar. 2020

ABSTRACT

Salmonella enterica is considered a zoonotic pathogen that acquires antibiotic resistance in livestock. In the current

study, a total of 18 Salmonella enterica isolates recovered from cloacal swabs of diseased and freshly dead broilers

were serotyped and assessed for susceptibility to clinically important antibiotics. The multi-resistant isolates were

examined for the presence of the antiseptic resistance genes including quaternary ammonium (qacEΔ1) and class 1

integron-integrase (intI1) by PCR. The results of serotyping of 18 Salmonella isolates indicated that five isolates

belonged to Salmonella Typhimurium, four isolates belonged to each of Salmonella Kentucky and Salmonella

Enteritidis, three isolates belonged to Salmonella Molade and one isolate belonged to each of Salmonella Inganda and

Salmonella Larochelle. Fifteen Salmonella isolates (83.3%) were multi-resistant to at least three antibiotics with a

multidrug resistance index value of 0.473. All of the intI1-positive strains carried qacEΔ1, confirming that the

qacEΔ1 gene is linked to the integrons. The study concluded that the presence of the qacEΔ1 resistance gene and

class 1 integrase in multi-drug resistant Salmonella strains might be contributed to co-resistance or cross-resistance

mechanisms.

Key words: intI1, Multidrug-resistant Salmonella, PCR, qacEΔ1

INTRODUCTION

were susceptible to ceftriaxone and 11 isolates harbored

class 1 integron. It has been also stated that different

serotypes of the genus Salmonella are resistant to various

antimicrobials and carry class 1 integron, which is

involved in antimicrobial multi-resistance (Vazquez et al.,

2005). In addition, the strains harboring integrons exhibit

the strongest resistance patterns (Muꢁoz et al., 2000).

G onzꢀlez et al. (1998) published the first evidence of

the presence of integrons in Gram-negative bacilli isolated

from biological residues in Chilean hospitals and found

the integrons are commonly associated with the family

Enterobacteriaceae. Integrons function as a system that

captures genes that confer selective advantages to the

bacterium. Integrons allow the bacterium to rapidly adapt

to ecological changes, due to their capacity to recognize a

wide variety of recombination sequences, their exchange

capacity and remote origin (Gonzꢀlez et al., 2004).

Integrons are genetic elements in plasmids and

transposons and frequently contain one or more genes

encoding resistance to antimicrobials (Stokes and Hall,

1989 ). Four classes of integrons are known (1, 2, 3, and 4),

with class 1 being predominant among the members of this

family both in the normal and pathogenic microbiota of

Salmonella Typhimurium continues to be among the most

common serovars isolated from poultry and a common

cause of human salmonellosis (Foley et al., 2011).

Salmonellae are prevalent in the environment and are

found in both domestic and wild animals as pathogens or

commensals. These bacteria can infect humans mainly via

contaminated food such as meat, dairy products, eggs,

fruits, vegetables (Yan et al., 2010).

The growing resistance of pathogenic bacteria to

antimicrobials has raised the concern that the widespread

use of antimicrobials in animal production may promote

the development of resistant bacteria or resistance genes

that can be transferred to bacteria which cause disease in

humans (Wegener et al., 1997). Microbial resistance is the

loss of sensitivity of a microorganism to an antimicrobial

that it was originally susceptible. This resistance can be

acquired by mutations in chromosomal DNA or the

acquisition of extra-chromosomal genetic materials

through plasmids and transposons (Vꢀzquez et al., 2002 ).

Zhang et al. (2004) studied 33 isolates of Salmonella

among healthy people in China and found that all isolates

To cite this paper: Ali NM and Mohamed FM (2020). Association of Antiseptic Resistance Gene (qacEΔ1) with Class 1 Integrons in Salmonella Isolated from Broiler Chickens. J.

World Poult. Res., 10 (2S): 214-222. DOI: https://dx.doi.org/10.36380/jwpr.2020.27

214

J. World Poult. Res., 10(2S): 214-222, 2020

animals (Goldstein et al., 2001 ). Integrons contribute to

the spread of antimicrobial resistance by gene transfer in a

variety of enteric bacteria, including Salmonella (Maynard

et al., 2003 ).

Isolation and biochemical identification of

Salmonella spp.

For isolation of Salmonella spp., the following

method was used in brief: inoculated BHI broth tubes were

incubated at 37^oC for 18 hours then a loopful was

transferred to Rappaport-Vassiliadis broth then incubated

at 41^oC aerobically for 24 hours. Samples were streaked

onto Brilliant Green agar with Novobiocin (40 μg/mL) and

inoculated Salmonella-Shigella agar and incubated for 24

hours at 37^oC aerobically. The isolated pure cultures of

Salmonella spp. were biochemically identified using the

following tests; oxidase, indole, methyl red, Voges

Proskauer, citrate utilization, urea hydrolysis, triple sugar

iron agar and lysine decarboxylase (Quinn et al., 2002).

Disinfectants are, however, employed during

production breaks as a routine part of the management of

poultry farms. Disinfectants such as Quaternary

Ammonium Compounds (QACs) that have been

introduced into farm environments. A particular concern is

that repeated usage of disinfectants may give rise to the

selection and persistence of bacteria with reduced

susceptibility not only to the antiseptics but possibly to

antibiotics as well (Randall et al., 2004 ). QAC gene which

is responsible for resistance to quaternary ammonium

compounds and disinfectants located on the 3' regions of

class 1 integron (Mazel, 2006 ). The mutant type QAC

gene recorded high prevalence among Salmonella Typhi

isolates (Hindi et al., 2014 ).

Chuanchuen et al. (2007) recorded that all of the

intI1-positive strains carry qacEΔ1in 3´ conserved

segment, confirming that the qacEΔ1gene is linked to the

integrons. QAC resistance and dissemination are very

important in the context of the global antibiotic resistance

problem, also exposure to QACs results in the

dissemination of integrons (Gillings, 2014). There is a

link between antibiotic resistance in nature and clinical

settings, which is favored by exposure to QACs (Forsberg

et al., 2012).

Serological identification

Isolates with biochemical profile compatible with

Salmonella spp. were identified serologically using

antisera (DENKA SEIKEN Co., Japan) in agglutination

tests on the basis of somatic O antigen and phase 1 and

phase 2 flagella antigens according to the Kauffmann-

White scheme (Grimont and Weill, 2007).

Antibiotic susceptibility

All Salmonella serotype isolates were studied via the

disk diﬀusion method to evaluate their resistance to

antibiotic disks. The criteria proposed by the National

Committee for Clinical Laboratory Standards (CLSI,

2013 ) was used to determine susceptibility rates. The

following 13 antibiotic discs (Oxoid) used in the current

study were: erythromycin (15µg), amoxicillin (30 µg),

cephradine (30 µg), colistin (10 µg), ciproﬂoxacin (5 µg),

enroﬂoxacin (5 µg), cefoxitin (30 µg), gentamicin (10 µg),

penicillin (10 µ), neomycin (10 µg), streptomycin (10µg),

florfenicol (15 µg) and amikacin (15 µg).

The present study aimed to detect class 1integron

(intI1) gene associated with antiseptic resistance gene

(qacEΔ1) in Salmonella serotypes, and correlate the

presence of these genes with multi-resistance to

antimicrobials, as verified by the plate inhibition test.

MATERIALS AND METHODS

Ethical approval

The research protocol was reviewed and approved by

the Institutional Animal Care and use Committee

(VetCU02122019103).

Multidrug resistance index

Resistance to more than three antibiotics was

recorded as Multi-Drug Resistance (MDR). The MDR

index of individual isolates was calculated by using the

equation adopted by Chandran et al. (2008). In this

equation, the number of antibiotics that the isolate was

resistant to these was divided by the total number of

antibiotics exposed. Isolates with MDR index values more

than 0.2 or 20% were considered highly resistant.

Sampling

Cloacal swaps were collected aseptically from 100

chickens suffering from digestive, respiratory and/or

locomotor disorders. The samples were then transported in

1.5 mL tubes containing 750μL of Brain Heart Infusion

(BHI) broth refrigerated in the icebox to the Laboratory of

Poultry Diseases Department, Faculty of Veterinary

Medicine, Assiut University, Assiut, Egypt.

Number of antibiotics resisted

MDR index =

x 100

Total number of antibiotics used

215

Ali et al., 2020

Biometra) and the data was analyzed through computer

software.

Experimental Design

Suspension of Salmonella isolates, in a saline

solution, was prepared with a 24h agar culture using the

McFarland scale,

a concentration of bacteria was

RESULTS

established, it means that the suspension contained

1800x10⁶Salmonella bacteria in 2 ml (Balicka et al.,

2007 ). A volume of 2 ml of this suspension was

administered to each of 30 six-day-old chicks. On the 15^th

day, birds were humanely killed and both ceca and cecal

tonsils were aseptically collected and cultured for the

presence of Salmonella spp.

The obtained results in the current study showed that on

examination of 100 cloacal broiler chicken samples

aseptically collected from diseased and freshly dead

chickens, 18 Salmonella isolates were recovered with an

overall percentage of (18%). Salmonella isolates were

motile, and they were positive with methyl red, citrate

utilization, H2S, LDC, Arginine dihydrolase and xylose.

However, they were negative with indole, Voges

Proskauer, urease, Gelatin liquefaction, ONPG.

PCR amplification and DNA sequencing

Ten Salmonella isolates were tested for the presence

of qacEΔ1 and integrase gene (intI1) using PCR as the

following:

Serotyping of Salmonella isolates revealed that

Salmonella Typhimurium was the most common serovar

(5 isolates) followed by Salmonella Kentucky and

Salmonella Enteritidis (4 isolates) and Salmonella Molade

(3 isolates), while Salmonella Larochelle and Salmonella

Inganda were represented by one isolate for each of them

(Table 2). The experimental chickens were infected with a

suspension containing 1800x10⁶bacteria in 2 ml. 85% of

birds had intensive clinical symptoms, Ruffled feathers,

diarrhea, weakness, and apathy. Postmortem examination

revealed severe congestion in the intestines, swollen liver

with necrosis and dehydration. Two cases died and

Salmonella was re-isolated from the intestines and cecum.

The antibiotic resistance pattern of the 18 Salmonella

isolates is shown in table 3. The obtained results showed

that 100% of the isolates were susceptible to amikacin

(100%) followed by Ciprofloxacin (88.89%) and

gentamicin (72.3%), norfloxacin/florfenicol (66.7%) and

streptomycin (61. 2%). High resistance rates were

observed against penicillin (100%), followed by

Amoxicillin (94.5%) and Erythromycin (83.3%). In

addition, 15 Salmonella isolates (83.3%) were multi-

resistant to at least three antibiotics with MDR index value

of 0.473 of which 10 isolates were tested for intI1 and

qacEΔ1 genes.

DNA extraction

DNA extraction from isolates was performed using

the QIAamp DNA Mini kit (Qiagen, Germany, GmbH)

with

modifications

from

the

manufacturer’s

recommendations. Briefly, 200 µl of the sample

suspension was incubated with 10 µl of proteinase K and

200 µl of lysis buffer at 56^OC for 10 min. After incubation,

200 µl of 100% ethanol was added to the lysate. The

sample was then washed and centrifuged following the

manufacturer’s recommendations. Nucleic acid was eluted

in 100 µl of elution buffer that was provided in the kit.

Oligonucleotide primer

Used primers were supplied by Metabion (Germany)

and listed in table 1.

PCR amplification

Primers were utilized in a 25- µl reaction containing

12.5 µl of DreamTaq Green PCR Master Mix (2X)

(Thermo Scientific), 1 µl of each primer of 20 pmol

concentration, 4.5 µl of water, and 6 µl of DNA template.

The reaction was performed in an applied biosystem 2720

thermal cycler.

Analysis of the PCR products

The products of PCR were separated by

electrophoresis on 1% agarose gel (Applichem, Germany,

GmbH) in 1x TBE buffer at room temperature using

gradients of 5V/cm. For gel analysis, 20 µl of the PCR

products were loaded in each gel slot. GeneRuler 100 base

pair DNA ladder (Fermentas, Sigma) was used to

determine the fragment sizes. The gel was photographed

The class 1 integron was detected in 10 multidrug-

resistant isolates giving characteristic bands at 280 base

pairs (Figure 1). The qacEΔ1 was also detected among

DNA products of 10 multidrug-resistant Salmonella

isolates giving characteristic bands at 362 base pairs

(Figure 2).

a gel documentation system (Alpha Innotech,

216

J. World Poult. Res., 10(2S): 214-222, 2020

Figure 1. Agarose gel electrophoresis showing PCR amplification at 280 base pair fragment for class 1 integron (conserved

segment) among DNA products of 10 multidrug-resistant Salmonella isolates collected from cloacal swaps from chickens,

Egypt. L: 100 base pair DNA ladder, Neg: Negative Control, Pos: Positive control

Figure 2. Agarose gel electrophoresis showing PCR amplification at 362 base pair fragment for qacEΔ1 gene among DNA

products of 10 multidrug-resistant Salmonella isolates collected from cloacal swaps from chickens, Egypt. L: 100 base pair

DNA ladder, Neg: Negative Control, Pos: Positive control

Table 1. Primers sequences, target genes, amplicon sizes, and PCR cycling conditions

Amplification (35 cycles)

Amplified

segment

(base pair)

Target

gene

Primers sequences

Primary

denaturation

Final

extension

Reference

Secondary

(5’- 3’)

Annealing

Extension

denaturation

F:TAAGCCCTACACAAATTGGGA

GAT AT

94˚C

5 min.

94˚C

30 sec.

58˚C

40 sec.

72˚C

40 sec.

72˚C

10 min.

Chuanchuen

et al. (2007)

qacEΔ1

362

280

R:GCCTCCGCAGCGACTTCCACG

F:CCTCCCGCACGATGATC

R:TCCACGCATCGTCAGGC

94˚C

5 min.

94˚C

30 sec.

50˚C

30 sec.

72˚C

30 sec.

72˚C

7 min.

Kashif et al.

(2013)

intI1

R: reverse, F: forward

217

Ali et al., 2020

Table 2. Results from Serotyping of Salmonella isolates collected from cloacal swaps from chickens, Egypt

Prevalence

Strain

Number

Salmonella Molade

16.6%

22.2%

5.5%

Salmonella Enteritidis

Salmonella Kentucky

Salmonella Inganda

Salmonella Typhimurium

Salmonella Larochelle

27.7%

5.5%

Table 3. Antibiotic resistance pattern of Salmonella isolates collected from cloacal swaps from chickens, Egypt

Salmonella isolates ( total number:18)

Antibiotics discs

Resistant

Sensitive

Number

Amikacin (15µg)

Amoxicillin (25µg)

Colistin (30µg)

Cephradine (30µg)

Ciprofloxacin (5µg)

Cefoxitin (30µg)

Erythromycin (15µg)

Florfenicol (15µg)

Gentamicin (10µg)

Norfloxacin (10µg)

Neomycin (30µg)

Penicillin (10u)

100

5.5%

94.5%

22.2%

55.5%

11.11%

66.6%

83.3%

33.3%

27.7%

33.3 %

50%

77.8%

44.5%

88.89%

33.4%

16.7%

66.7%

72.3%

66.7%

50%

100%

38.8%

61.2%

Streptomycin (10µg)

34.5% of chicken samples in Ethiopia. The above-

mentioned discrepancy in prevalence rate of Salmonella

spp. could be attributed to the disparity in sampling

schemes, types of samples, protocols of Salmonella

detection and geographic differences as well as hygienic

practices.

DISCUSSION

The obtained results in the current study showed that on

examination of 100 chicken cloacal swabs samples

aseptically collected from diseased and freshly dead

chickens, 18 Salmonella isolates were obtained with a

percentage of 18%. However, previous studies reported

slightly lower values for Salmonella isolation. In this

respect, the prevalence of Salmonella was 12.8% in

broilers farms in Egypt (Orady et al., 2017), 12.6% in

poultry farms in Kuwait (Al-Zenki et al., 2007) and 10%

were isolated from internal organs (liver, spleen, and

heart) of broilers (El-Azzouny, 2014). However, a much

lower prevalence of Salmonella was reported in other

localities in Egypt where an overall prevalence of 1.7%

(Ahmed et al., 2009 ), 2% and 2.5% (Mohamed et al.,

1999 ) was found in Sharkia, Gharbia, and Kafr-Elsheikh

governorates, respectively. Also, other studies showed

more variable prevalence rates of Salmonella isolates

worldwide. Salmonella isolates were found in 3.1% of

internal organs of chickens in North Vietnam (Hanh et al.,

2006 ), but Molla et al. (2003) isolated Salmonella from

In concordance with the previous study by Bywater

et al. (2004), the isolation of Salmonella with a higher

percentage from broiler chickens necessitate the

application of biosecurity program inside farms beside

using alternatives to antimicrobials such as bacteriophages

and herbal extracts for cutting the horizontal transmission

of Salmonella to broiler carcasses (Elkenany et al., 2019 ).

In agreement with previous studies, Salmonella

Typhimurium was the most common serovar isolated from

broilers in many countries (Verma and Gupta, 1995;

Moussa et al., 2010; Rabie et al., 2012; Borges et al.,

2015; Ammar et al., 2016; Orady et al., 2017 ). It

accounted for 27. 7% of total Salmonella isolates in the

current study. Other serotypes isolated in the present study

were Salmonella Enteritidis and Salmonella Kentucky

with a percentage of 22.2% and Salmonella Molade with a

218

J. World Poult. Res., 10(2S): 214-222, 2020

percentage of 16.6%, while Salmonella Inganda and

Hindi et al. (2014) recorded that class 1integron (intI1)

gene was not observed in any of the 100 multidrug-

resistant Salmonella spp. as it was not detected by PCR.

The integron has also been found in other

Enterobacteriaceae but it is not very frequent as in

Salmonella (Guerra et al., 2004). The uncontrolled use of

antibiotics would increase the number of multidrug-

resistant isolates and integrons prevalence, which by time,

could be a significant public health threat (Orady et al.,

2017 ).

Salmonella Larochelle recorded the lowest percentage

(5.5%). These results are consistent with the results of

Orady et al., (2017) who mentioned Salmonella Enteritidis

and Salmonella Typhimurium are the most common

serovars recording 15.6%, while Salmonella Kentucky and

Salmonella Molade accounted for 6.2% and 3.1%,

respectively.

Regarding the sensitivity pattern of each of the 18

isolated Salmonella serovar, 15 Salmonella isolates had

multi-resistance to at least three antibiotics with an MDR

index value of 0.473, whereas 3/18 (16.7%) had MDR

index value of 0.112 ≤0.2. These results differ from those

reported by Orady et al . (2017) who mentioned that 62.5%

of salmonella isolated from chickens showed MDR

phenotypes to at least three classes of antimicrobials. Also,

Singh et al., (2010) reported that all tested Salmonella spp.

isolates from chickens were resistant to at least one

antimicrobial compound. This increased MDR could be

attributed to the wide range, irresponsible and misuse of

antibiotics in poultry farms.

As demonstrated in the present study, all isolates

expressing class 1 integrons were positive for the presence

of the qacEΔ1gene, indicating the positive correlation

between them. In the same context, class 1 integrons

were associated with qacEΔ1 and sul1 and commonly

detected in clinical isolates of Salmonella (Hsu et al.,

2006). In addition, Chuanchuen et al. (2007) mentioned

that the intI1 gene was identified in 23 isolates (70%) with

qacEΔ1 and all of the intI1-positive strains carried

qacEΔ1 in 3´ conserved segments, confirming that the

qacEΔ1 gene is linked to the integrons. Moreover, Gaze et

al. (2005) reported a link between increased class 1

integron frequency as well as increased QAC resistance.

Recently, an unusual 3´ conserved sequence regions

with QAC linked to a sul3 domain was found in plasmid-

borne class 1 integrons in different Salmonella serovars

(Antunes et al., 2004). Also, the 5´ CS region contains

intI1, the typical 3´ CS region usually consists of qacEΔ1;

encoding resistance to quaternary ammonium compounds,

sul1; encoding resistance to sulphonamide (Fluit and

Schmitz, 2004). Integrons play a significant role in the

acquisition and mobilization of QAC resistance genes

(Cambray et al., 2010 ). Also, plasmid-associated QAC

resistance genes are transferred between non-pathogenic

and pathogenic bacteria exposed to QACs, a process that

also leads to the co-selection of resistance to other

contaminants (Katharios et al., 2012 ). So, Antibiotic and

QAC resistance genes are both carried on class 1

integrons, which raises concerns that QAC exposure

resistance may co-select for antibiotic resistance by

selecting for class 1 integrons (Chuanchuen et al., 2007 ).

On the contrary, Salmonella Enterica strains positive

for qacE1 but without intI1 were also identified. Carriage

of the qacE1 gene may be on other elements or

integrated into the chromosome (Chuanchuen et al.,

2007 ). Also, the class 1 integron gene (qacE1-SulI ) was

not detected in any Salmonella isolates (Diarrassouba et

al., 2007 ).

In the present study, all isolates were fully

susceptible to amikacin (100%), which was the most

effective antibacterial agent against Salmonella infection

followed by ciprofloxacin (88.89%), Colistin (77.8%),

gentamicin (72.3%) followed by streptomycin (61.2%).

Comparable findings have been reported by Orady et al.

(2017) and Łukasz and Popowska (2016).

It has been stated that there is an association between

class 1 integrons and the development of antibiotic

resistance (Guerra et al., 2003; Orady et al., 2017). In

addition, class 1 integrons are the most frequently found

integrons that contribute to MDR in gram-negative

bacteria (Fluit and Schmitz, 2004; Hsu et al, 2006 ). In the

current study, class 1 integron was screened among the

obtained multidrug-resistant Salmonella isolates. PCR

amplification revealed that Class 1 integrons were detected

in 10 tested MDR Salmonella isolates (100 %). In

agreement with Ammar et al. (2016), class 1 integrons

contribute significantly to antibiotic resistance in

Salmonella isolates. There is a discrepancy in the

percentage of Salmonella isolates expressing the presence

of class 1 integrons as revealed by previous studies.

Comparable results to the current results have been

obtained by Antunes et al. (2004) and Orady et al. (2017)

who mentioned that class 1 integrons were detected in

almost all isolates (99% and 95%, respectively). However,

lower percentages have been demonstrated by Gautam et

al. (2017) in India (69.9%) and Shahada et al. (2006) in

China (24.5%). Contrarily, Okamoto et al. (2009) and

219

Ali et al., 2020

Cambray G, Guerout AM and Mazel D (2010). Integrons. Annual

CONCLUSION

Reviews of Genetics, 44: 141-166. DOI: 10.1146/annurev-genet-

102209-163504

The majority of Salmonella isolates were multi-drug

resistant to at least three antibiotics. The presence of

integrons among Salmonella isolates is considered to be an

important contributor to the development of antibiotic

resistance. The presence of class 1 integrons in all of the

qacEΔ1-positive strains confirms a significant association

between them and confers cross-resistance to different

groups of antibacterial. Increasing resistance among

Salmonella isolates harboring class 1 integron and

qacEΔ1gene are linked to the excessive use of

antimicrobials and disinfectants in broilers farm.

Chandran A, Hatha AA, Varghese S and Sheeia KM (2008): Prevalence

of multiple drug resistant Escherichia coli serotypes in a tropical

estuary, India. Microbes and Environment, 23(2):153-158. DOI:

10.1264/jsme2.23.153

Chuanchuen R, Khemtong S and Padungtod P (2007). Occurrence of

qacE/qacE1 genes and their correlation with class 1 integrons in

Salmonella enterica isolates from poultry and swine. Southeast

Asian Journal of Tropical Medicine and Public Health, 38: 855–

862. Available at: https://www.ncbi.nlm.nih.gov/pubmed/18041302

CLSI (2013). Performance Standards for Antimicrobial Susceptibility

testing; twenty-third informational supplement. CLSI document

M100–S23. Wayne, PA: Clinical and Laboratory Standards

Institute.

Available

at:

https://www.facm.ucl.ac.be/intranet/CLSI/CLSI-M100S23-

susceptibility-testing-2013-no-protection.pdf

Diarrassouba F, Diarra MS, Bach S, Delaquis P, Pritchard J, Topp E, and

Skura B J (2007). Antibiotic resistance and virulence genes in

commensal Escherichia coli and Salmonella isolates from

commercial broiler chicken farms. Journal of Food Protection, 70

(6): 1316–1327. DOI: 10.4315/0362-028x-70.6.1316

DECLARATION

Competing interests

The authors declare no conflict of interest.

El-Azzouny MME (2014). Occurrence of virulence genes among

multidrug resistant Salmonellae isolated from broilers. Ph. D.

Thesis, Faculty of Veterinary Medicine, Bacteriology, Mycology,

and Immunology Department. Zagazig University.

Authors' contributions

Both authors contributed equally to this work.

Elkenany R, Elsayed M M, Zakaria AI, El-sayed SA and Rizk MA

(2019). Antimicrobial resistance profiles and virulence genotyping

of Salmonella enterica serovars recovered from broiler chickens

and chicken carcasses in Egypt. BMC Veterinary Research, 15:

124. DOI: 10.1186/s12917-019-1867-z

REFERENCES

Fluit AC and Schmitz FJ (2004). Resistance integrons and super-

integrons. Clinical Microbiology and Infection, 10: 272-88. DOI:

10.1111/j.1198-743X.2004.00858.x

Ahmed AM, Shimabukuro H and Shimamoto T (2009). Isolation and

molecular characterization of multidrug-resistant strains of

Escherichia coli and Salmonella from retail chicken meat in Japan.

Journal of Food Science, 74 (7): 405-410. DOI: 10.1111/j.1750-

3841.2009.01291.x

Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J and Ricke SC

(2011). Population dynamics of Salmonella enterica serotypes

incommercial egg and poultry production. Applied Environmental

Microbiology, 13: 4273-4279. DOI: 10.1128/AEM.00598-11

Al-Zenki S, Al-Nasser A, Al-Safar A, Alomirah H, Al-Haddad A,

Hendriksen RS and Aarestrup FM (2007). Prevalence and antibiotic

resistance of Salmonella isolated from

processing plant environment in the state of Kuwait. Foodborne

Pathogens and Disease, (3): 367-373. DOI:

10.1089/fpd.2007.0017

a poultry farm and

Forsberg KJ, Reyes A, Bin W, Selleck EM, Sommer MOA and Dantas G

(2012). The shared antibiotic resistome of soil bacteria and human

pathogens.

Science,

337:

1107-1111.

DOI:

10.1126/science.1220761

Ammar AM, Attia AM, Abd El-Aziz NK, Abd El Hamid MI and El-

Demerdash AS (2016). Class 1 integron and associated gene

cassettes mediating multiple-drug resistance in some foodborne

pathogens. International Food Research Journal, 23 (1): 332-339.

Available at: https://www.researchgate.net/publication/291286908

Gautam RK, Kakatkar AS, Karani MN, Shashidhar R and Bandekar JR

(2017). Salmonella in Indian ready-to-cook poultry: antibiotic

resistance and molecular characterization. Microbiology Research,

8(1): 15-19. DOI: 10.4081/mr.2017.6882

Gaze WH, Abdouslam N, Hawkey PM and Wellington EM

(2005). Incidence of class 1 integrons in a quaternary

Antunes P, Machado J, Sousa JC and Peixe L (2004). Dissemination

amongst humans and food products of animal origin of

ammonium

compound-polluted

environment.

Salmonella Typhimurium clone expressing an integron-borne

OXA-30 ß-lactamase. Journal of Antimicrobial Chemotherapy, 54:

429-434. DOI: 10.1093/jac/dkh333

An timi crobia l Agen ts and Ch emoth erap y, 49 (5 ):

1802-1807. DOI:10.1128/AAC.49.5.1802–1807.2005

Gillings MR (2014). Integrons: past, present, and future. Microbiology

and Molecular Biology Reviews, 78: 257-277. DOI:

10.1128/MMBR.00056-13

Balicka -Ramis A, Wojtasz-Pająk A, Pilarczyk B and Ramisz A (2007).

The effect of chitosan on body weight and protection against

Salmonella Gallinarum infection in broiler chickens. Archiv fur

Tierzucht, 50 (3): 288-293. DOI: 10.5194/aab-50-288-2007

Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B,

Grady M, Liebert C, Summers AO, White DG and Maurer JJ

(2001). Incidence of class 1 and 2 integrases in clinical and

commensal bacteria from livestock, companion animals, and

exotics. Antimicrobial Agents and Chemotherapy, 45(3): 723-726.

DOI: 10.1128/AAC.45.3.723-726.2001

Borges P, Bergseng E, Eid T and Gobakken T (2015). Impact of

maximum opening area constraints on profitability and biomass

availability in forestry – a large, real world case. Silva Fennica, 49

(5): 1347. DOI: 10.14214/sf.1347.

Bywater R, Deluyker H, Deroover E, DeJong A, Marion H, McConville

M, Rowan T, Shryock T, Shuster D, Thomas V, Valle M and

Walters J (2004). A European survey of antimicrobial susceptibility

among zoonotic and commensal bacteria isolated from food-

producing animals. Journal of Antimicrobial Chemotherapy, 54 (4):

744-754. DOI: 10.1093/jac/dkh422

Gonzꢀlez GR, Mella SM, Zemelman RZ, Bello HT and Domꢂnguez MY

(2004). Integrones y cassettes genꢃticos de resistencia: estructura y

rol frente a los antibacterianos. Revista Mꢃdica de Chile, 132(5):

619- 626. DOI: 10.4067/s0034-98872004000500013

220

J. World Poult. Res., 10(2S): 214-222, 2020

Gonzꢀlez GR, Sossa K, Mella SM, Zemelman RZ, Bello HT and

Moussa IM, Gassem MA, Al-Doss AA, Sadik WAM and Mawgood AAL

(2010). Using molecular techniques for rapid detection of

Salmonella serovars in frozen chicken and chicken products

collected from Riyadh, Saudi Arabia. African Journal of

Biotechnology, 9: 612-619. DOI: 10.5897/AJB09.1761

Domꢂnguez MY (1998). Presence of integrons in isolates of

different biotypes of Acinetobacter baumannii from Chilean

hospitals. FEMS Microbiology Letter, 161: 125-128. DOI:

10.1111/j.1574-6968.1998.tb12937.x

Guerra B, Junker E and Helmuth R (2004). Incidence of the recently

described sulfonamide resistance gene sul3 among German

Salmonella enterica strains isolated from livestock and food.

Antimicrobial Agents and Chemotherapy, 48: 2712–2715.

DOI: 10.1128/AAC.48.7.2712-2715.2004

Muꢁoz J, Gonzꢀlez G, Bello H, Domꢂnguez M, Mella S and Zemelman R

(2000). Prevalencia de integrones en cepas intrahospitalarias de

Pseudomonas aeruginosa y Acinetobacter spp. y su relaciꢅn con la

resistencia a antimicrobianos aminoglicosidos. Anales Microbioles,

3:72.

Guerra B, Junker E, Schroeter A, Malorny B, Lehmann S and Helmuth R

(2003). Phenotypic and genotypic characterization of antimicrobial

resistance in German Escherichia coli isolates from cattle, swine

and poultry. The Journal of Antimicrobial Chemotherapy, 52:489–

492. DOI: 10.1093/jac/dkg362

Okamoto AS, Andreatti Filho RL,Rocha TS, Menconi A and Marietto-

Gonçalves GA (2009). Detection and transfer of antimicrobial

resistance gene integron in Salmonella Enteritidis derived from

avian material. Brazilian Journal of Poultry Science, 11 (3): 195 –

201.

Available

at:

http://www.scielo.br/pdf/rbca/v11n3/v11n3a09.pdf

Hanh TT, Thanh NT, Thoa HQ, Thi LT, Thuan LM and Ly NTH (2006).

Prevalence of Salmonella spp. in poultry in Vietnam. Annals of the

New York Academy of Sciences, 1081: 266-268. DOI:

10.1196/annals.1373.034

Orady R M, Helmy SM, Ammar AMA, Hassan WM, Abo Remela EM

and EL-Demerdash AS (2017). Molecular characterization of class

1 integrons and antibiotic resistance genes in Salmonella enterica

isolated from chicken. Global Veterinaria, 18 (5): 322-331. DOI:

10.5829/idosi.gv.2017.322.331

Hindi AK, Addos SA and Ahmed EE (2014). Molecular study on

multidrug resistant of Salmonella enterica isolated from patient

with enteric fever in Najaf - Province/Iraq. International Research

Quinn JP, Carter ME, Markey BK and Carter GR (2002). Clinical

Veterinary Microbiology. 3rd ed. Baillere, Tindall, London.

Journal of Medical Sciences,

www.isca.in

(7): 12-16.

Available at:

Available

at:

https://books.google.com.sa/books?id=FUJYAQAAQBAJ&pg=PA

538&lpg=PA538&dq=Clinical+Veterinary+Microbiology.+3rd+ed.

+Baillere,+Tindall,+London

Hsu SC, Chiu TH, Pang JC, Hsuan-Yuan CH, Chang GN and Tsen HY

(2006). Characterisation of antimicrobial resistance patterns and

class 1 integrons among Escherichia coli and Salmonella enterica

serovar Choleraesuis strains isolated from humans and swine in

Taiwan. International Journal of Antimicrobial Agents, 27: 383-

391. DOI: 10.1016/j.ijantimicag.2005.11.020

Rabie NS, Khalifa NO, EI-Radwan

M and Afify JSA (2012).

Epidemiological and molecular studies of Salmonella isolates from

chicken, chicken meat and human in Toukh, Egypt. Global

Veterinaria,

128-132.

Available

at:

Kashif J, Buriro R, Memon J, Yaqoob M, Soomro J, Dongxue D, Jinhu H

and Liping W (2013). Detection of class 1 and 2 integrons, β-

lactamase genes and molecular characterization of sulfonamide

resistance in Escherichia coli Isolates recovered from poultry in

China. Pakistan Veterinary Journal, 33 (3): 321-324. Available at:

https://www.researchgate.net/publication/331167659

https://www.researchgate.net/publication/280975886

Randall LP, Cooles SW, Osborn MK, Piddock LJ and Woodward MJ

(2004). Antibiotic resistance genes, integrons and multiple

antibiotic resistance in thirty-five serotypes of Salmonella enterica

isolated from humans and animals in the UK. The Journal of

Antimicrobial Chemotherapy, 53 (2): 208-216. DOI:

10.1093/jac/dkh070

Katharios-Lanwermeyer S, Rakic-Martinez M, Elhanafi D, Ratani S,

Tiedje JM and Kathariou S (2012). Coselection of cadmium and

benzalkonium chloride resistance in conjugative transfers from

nonpathogenic Listeria spp. to other Listeriae. Applied and

Shahada F, Chuma T, Tobata T and Okamoto K (2006). Molecular

epidemiology of antimicrobial resistance among Salmonella

enterica serovar Infantis from poultry in Kagoshima, Japan.

International Journal of Antimicrobial Agents, 28 (4): 302-307.

DOI: 10.1016/j.ijantimicag.2006.07.003

Environmental

Microbiology,

78:

7549-7556.

DOI:

10.1128/AEM.02245-12

Grimont PAD and Weill FX (2007). Antigenic Formulae of the

Salmonella serovars. WHO Collaborating Centre for Reference and

Research on Salmonella, Institut Pasteur, 28 rue du Dr. Roux,

Singh S, Yadav AS, Singh SM and Bharti P (2010). Prevalence of

Salmonella in chicken eggs collected from poultry farms and

marketing channels and their antimicrobial resistance. Food

Research International, 43: 2027–2030. Available at:

https://doi.org/10.1016/j.foodres.2010.06.001

75724

Paris

Cedex

15,

France.

Available

at:

https://www.researchgate.net/publication/283428414

Łukasz M and Popowska (2016). Antimicrobial resistance of

Salmonella spp. isolated from food. Roczniki Paꢄstwowego

Zakładu Higieny, 67 (4): 343-358. Available at:

https://www.ncbi.nlm.nih.gov/pubmed/27922740

Stokes HW and Hall RM (1989). A novel family of potentially mobile

DNA elements encoding site-specific gene-integration functions:

integrons.

Molecular

Microbiology,

3:1669-1683.

DOI:

10.1111/j.1365-2958.1989.tb00153.x

Maynard C, Fairbrother JM, Bekal S Sanschagrin F, Levesque RC,

Brousseau R, Masson L, Larivie`re S and Harel J (2003).

Antimicrobial resistance genes in enterotoxigenic Escherichia coli

O149:K91 isolates obtained over a 23-year period from pigs.

Antimicrobial Agents and Chemotherapy, 47:3214–3221. DOI:

10.1128/aac.47.10.3214-3221.2003

Vꢀzquez NJ, Lꢅpez VY, Suꢀrez GF, Eslava C and Verdugo RA (2002).

Caracterizaciꢅn y clonaciꢅn de los genes que expresan una

enterotoxina LT en Salmonella gallinarum. Anales del 27o

Congreso Centroamericano y del Caribe de Avicultura; La Habana.

Available

at:

http://www.scielo.br/scielo.php?script=sci_nlinks&ref=000155&pi

d=S1516-635X200900030000900033&lng=en

Mazel D (2006). Integrons: agents of bacterial evolution. Nature Reviews

Microbiology, 4 (8):608–20. DOI: 10.1038/nrmicro1462

Vꢀzquez-Navarrete J, Cꢅrdoba BC, Lꢅpez VY and Mancera MA (2005).

Identificacion Del gene da la integrasa Tipo I y perfil da resistꢆncia

antimicrobiana em Salmonella Enteritidis. Cuajimalpa [cited 2005

nov 24]. Available at: www.vet-uy.com/articulos/artic_micro/001/

micro001.htm

Mohamed LN, Samaha HA, Draz AA and Haggag YN (1999).

Salmonellae among birds and human beings. Alexandria Journal of

Veterinary Sciences, 15(1): 147-154.

Molla B, Mesfin A and Alemayehu D (2003). Multiple antimicrobial-

resistant Salmonella serotypes isolated from chicken carcass and

giblets in DebreZeit and Addis Ababa, Ethiopia. Ethiopian Journal

Verma JC and Gupta BR (1995). Occurrence of Salmonella serotypes in

animals in India. Indian Journal of Comparative Microbiology

Health

Development,

17(2):

131-149.

DOI: 10.4314/ejhd.v17i2.9854

221