2020, Scienceline Publication

JWPR

Poultry Research

J. World Poult. Res. 10(2S): 172-179, June 14, 2020

Journal of World’^s

Research Paper, PII: S2322455X2000022-10

License: CC BY 4.0

DOI: https://dx.doi.org/10.36380/jwpr.2020.22

The Impact of Alpha-lipoic Acid Dietary Supplementation on

Growth Performance, Liver and Bone Efficiency, and Expression

Levels of Growth-Regulating Genes in Commercial Broilers

Osama A. Sakr ¹, Eldsoky Nassef², Sabreen E. Fadl ^3*, Hazem Omar ⁴, Emad Waded ⁵, and Seham El-Kassas ⁶

¹Biochemistry, Nutritional Deficiency Diseases and Toxicology Unit, Animal Health Research Institute – Kafrelsheikh (ARC), Egypt

²Nutrition and Clinical Nutrition Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt.

³Biochemistry Dept., Faculty of Veterinary Medicine, Matrouh University, Matrouh, Egypt.

⁴Pharmacology Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt.

⁵Clinical Pathology Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt.

⁶Animal, Poultry and Fish Breeding and Production, Department of Animal Wealth Development, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt

*Corresponding author's Email: nourmallak@yahoo.com; ORCID: 0000-0001-5541-6159

Received: 29 Jan. 2020

Accepted: 09 Mar. 2020

ABSTRACT

Increasing bird growth is a crucial demand for all poultry producers. This occurs by the genetic improvement of the

existing breeds and by improving the feeding management. The present study investigated the impact of Alpha-

Lipoic Acid (ALA) supplementation in the diet on performance, serum parameters, tibia bone composition, and the

expression levels of growth-related genes in chickens. A total of 120 day-old broiler chicks (Cobb 505) were used

and divided into four groups. The control group was fed on a basal diet without the ALA supplement. The birds in

groups of A50, A100, and A200 were fed on the formulated diet supplemented with ALA at doses of 50, 100, and

200 mg/kg of diet, respectively for 35 days. Results indicated that ALA supplementation significantly improved the

birds’ growth performance. This effect was associated with a marked upregulation of mRNA levels of

GHR and IGFR and a significant downregulation of MSTN expression level. In addition, the ALA dietary provision

caused a distinct improvement in liver function and bone efficiency. Thus, the improving effect of ALA on birds’

growth performance is mediated by modulating the growth-regulating genes. In conclusion, ALA could be used as a

good growth-promoter in dietary supplements.

Keywords: Alpha-lipoic Acid; Bone Efficiency; Broilers; Gene Expression; Growth Performance.

INTRODUCTION

membranes, leading to nutrient availability (Kofuji et al.,

2008).

Increasing bird’s growth is a crucial demand for all poultry

producers. This occurs by the genetic improvement of the

existing breeds and by improving the feeding management

(Petracci and Cavani, 2012). The latter is achieved through

the dietary provision of feed additives such as

antioxidants, enzymes, organic acids, probiotics, prebiotics

and synbiotics along with herbal extracts to enhance the

bird’s growth performance and meat quality (Sohaib et al.,

2018 ). Alpha-lipoic acid (ALA) is an effective

multifunction feed additive and its use ranges from

therapeutic applications to the dietary supplementations. It

is widely dispensed in foods and has both water and fat-

soluble properties thus it is absorbed from the diet (Packer

et al., 1995). After absorption, ALA passes through cell

ALA plays an important role in energy metabolism

as a result of its functions as a cofactor in many reactions

that produce energy (Li et al., 2014). Thus, its dietary

provision to farm animals, particularly broiler chickens,

along with the cell produced it naturally in small quantity,

directly scavenges free radicals and enhances fatty acid

mobilization and energy expenditure. Therefore, it has a

promoting effect on growth and the immune system, as

well as decreases inflammation and oxidative stress

(Sohaib et al., 2018 ). Recently, the application of ALA in

broilers' diet is widespread to promote growth and

improve the quality of carcass meat. It regulates the birds’

growth performance by promoting energy metabolism and

improving antioxidant status and immune response (Bai et

al., 2012 ).

To cite this paper: Sakr OA , Nassef E, Fadl SE , Omar H, Waded E , and El-Kassas S (2020). The Impact of Alpha-lipoic Acid Dietary Supplementation on Growth Performance,

Liver and Bone Efficiency, and Expression Levels of Growth-Regulating Genes in Commercial Broilers. J. World Poult. Res., 10 (2S): 172-179. DOI:

https://dx.doi.org/10.36380/jwpr.2020.22

172

J. World Poult. Res., 10(2S): 172-179, 2020

ALA also protects liver of the broiler from damage

Measurement of tibia bone composition

as a result of chronic exposure to the low dose of aflatoxin

B1 through improvement of plasma total protein, albumin,

alkaline phosphatase, and the activities of alanine

aminotransferase (ALT) and aspartate aminotransferase

(AST) (Li et al., 2014). The aim of the present study was

to evaluate the effect of ALA on performance, the liver

and bone efficiency, and expression level of growth-

related genes in chicken broilers.

After slaughtering, the left tibia bone of each

slaughtered bird was isolated. The bones were dried in hot

air oven at 60 °C for 48 hr to determine DM and moisture

contents. The dried bones were finely ground and

incinerated in the muffle furnace at 600 °C for 2 hr to

determine ash content according to AOAC (2019).

Calcium and phosphorus contents of tibia ash were

determined by atomic absorption spectrometry.

Table 1. Ingredients and nutrients composition of the

MATERIALS AND METHODS

basal diets.

Diets

Items

Ethical approval

Finisher

(25 day-

slaughter)

Starter

(0-10 days) (11-24 days)

Grower

The current study was approved by the Ethical

Committee for live birds sampling at the Animal Health

Research Institute, Egypt (License No. AHRI 35429).

Ingredients (%)

Yellow Corn

58.0

30.0

Soybean meal (48%)

Corn gluten meal

(60%)

6.1

1.5

6.1

2.1

1.6

2.5

Birds and experimental design

Soy oil

120 one-day-old chicks (Cobb-505 broiler strain)

were used in the present study. Chicks were gained from a

local farm and housed in the room. The room was cleaned

and well-ventilated where the chicks were kept under good

sanitation and hygienic management. The feed and water

were available ad libitum. Chicks were allotted into four

groups randomly with average body weight = 51.72±0.17

g/chick. For each treatment, 3 replicates contained 10

chicks were used. The C group (control one) was fed on a

basal diet (Table 1). The basal diet was prepared according

to broiler nutrition specification, 2007. The A50, A100,

and A200 were fed on the formulated diet supplemented

with ALA (Thiotacid^®= It is an antioxidant made in EVA

PHARMA Company, Egypt, in the form of tablets, each

tablet contains 600 mg ALA) in a dose of 50, 100, and 200

mg/kg diet, respectively. All birds were weighed at the

starting of the design and every week for five weeks while

the diet was weighed every day to determine the feed

intake and calculate the feed conversion ratio (FCR).

Monocalcium

1.85

1.5

phosphate¹

Limestone²

1.12

0.45

0.25

0.43

0.3

0.95

0.35

0.2

0.4

0.3

0.9

0.2

0.4

0.3

Lysine³

DL-Methionine⁴

Common salt

Premix¹

Nutrients composition

ME (Kcal/Kg)

Crude protein %

Lysine %

Methionine

Methionine & Cysteine

Calcium

3084

23.2

1.44

0.68

1.06

1.08

0.5

3176

21.14

1.23

0.6

0.96

0.91

0.45

0.18

3215

19.0

1.09

0.54

0.86

0.87

0.42

0.18

Available phosphorus

Sodium

0.2

¹Premix provides Vit A (12000 Iu), Vit D (5000 Iu), Vit E (50 mg), Vit

K3 (3 mg), Vit B1 (3 mg), Vit B2 (8 mg), Vit B6 (4 mg), Vit B12 (0.016

mg), nicotinic acid (60 mg), pantothinic acid (15 mg), folic acid (2 mg),

biotin (0.2 mg), iron (40 mg), copper (16 mg), zinc (100 mg), manganese

(120 mg), iodine (1.25 mg), selenium (0.3 mg) per 1 kg diet.

Real-time polymerase chain reaction

Sample collection

From each treated group, six muscle samples (one

sample/bird) were collected from the slaughtered birds and

used for the gene expression analysis. The muscle samples

were gathered into clean Eppendorf tubes, quickly frozen

in liquid nitrogen then stored (-80 °C) until use.

Sample collection and measurements of serum

parameters

After 5 weeks, six birds from each group (2 birds/

replicate) were randomly selected and slaughtered to

collect the blood samples. After the coagulation of blood,

the serum samples were separated (centrifugation at 3000

rpm for 15 min) and kept at -20 °C. The serum was used to

determine total protein, albumin, ALT, AST, and Alkaline

phosphatase which were estimated using commercial kits

(Bio-Diagnostic Company). While globulin was calculated

by mathematical subtraction of albumin value from that of

the total protein.

Total RNA extraction and cDNA synthesis

Total RNA from muscle samples was extracted using

easy RED total RNA extraction kits (Cat. No. 17063,

Intron Biotechnology, Inc.) according to the

manufacturer's instructions. Briefly, about 30 mg of

muscle samples were ground into liquid nitrogen using a

mortar and pestle. Then, 1 ml of easy RED and 200 µl

chloroform were added, followed by centrifugation at

173

Sakr et al., 2020

maximum speed (20817 xg). After that, RNA was pelleted

improved FCR results when compared with the control

group.

and eluted in RNase free water (El-Kassas et al., 2016).

RNA integrity was verified by agarose gel electrophoresis.

A fixed concentration of RNA (2 μg) was reverse

transcribed using the SensiFAST™ cDNA synthesis kit

(Bioline, United Kingdom).

Serum liver function

Effect of dietary ALA supplementation on serum

liver function of broiler chicken is presented in Table 4.

Statistical analysis of the obtained result revealed that

ALA supplementation (group A50, A100, and A200)

significantly decreased (p≤0.05) serum ALT, AST, and

AKP when compared with the control group. On the other

hand, statistical analysis of the obtained data indicated that

the inclusion rate of ALA (group A50, A100, and A200)

significantly increased (p≤0.05) serum proteins when

compared with the control group.

qRT-PCR assay

Specific primers (Table 2) were used to amplify

GHR: growth hormone receptor, IGF1R: Receptor of

insulin-like growth factor 1, and MSTN: Myostatin using

the β actin as a housekeeping (internal standard) gene. The

qPCR reaction mix, for each gene, contained 10 µl of

SensiFast™ SYBR Lo-Rox master mix (Bioline, United

Kingdom), 0.5 µM of each primer and 2 µl of cDNA. The

qPCR assay for each tested gene was done in duplicate

using Stratagene MX300P real-time PCR system (Agilent

Technologies) with thermal cycling conditions were:

initial denaturation at 95^oC for 15 minutes, followed by 40

cycles at 95^oC for 15 seconds, annealing for 1 minute at

60^oC for all genes. The dissociation curves were analyzed

showing only one peak at a specific melting temperature

for all tested genes indicating specifically amplified PCR

products. The relative mRNA expression level for each

gene was calculated using the 2^−ΔΔctmethod as described

by Livak and Schmittgen (2001). In this context, the fold

change for each gene was normalized against the house-

keeping gene (β actin) and its comparable values of the

control group (feeding basal diet without ALA

supplementation).

Tibia bone characteristics

Results of tibia bone analysis are shown in Table 5.

Dietary supplementation of ALA (group A50, A100, and

A200) significantly increased (P≤0.05) dry matter and ash

contents in tibia bone of broiler chickens as compared to

the control group. Broilers fed 100 mg ALA/kg diet

significantly increased (P≤0.05) calcium concentration in

tibia bone when compared with the control group.

Moreover, there was no significant difference in

phosphorus concentration in tibia bone among all groups.

Expression levels of growth-related gene

Supplementing ALA into the birds’ diet significantly

modified the relative mRNA transcript levels of GHR,

IGF1R, and MSTN compared to their expressions in the

case of birds fed basal diet (P = 0.009, P = 0.03, and P =

0.026, respectively). For GHR (Figure 1), ALA

supplementation at 50 mg/kg diet stimulated a significant

increase of GHR mRNA transcript levels (P = 0.002).

Interestingly, increasing the level of ALA supplementation

to 100 mg/kg diet significantly increased GHR gene

expression level (P=0.014) but less than that in the case of

50 mg/kg diet supplementation. It resulted in an only 1.9-

fold increase of the relative GHR gene expression level

compared to 2.99-fold in the case of A 50 group.

However, the ALA dietary provision at 200 mg/kg diet

was able to markedly upregulate the GHR gene expression

level (P=0.004). It resulted in 4.1-fold higher than that of

non-supplemented birds (C).

Statistical analysis

The statistical analysis of data was performed using

SPSS version 20. One-way ANOVA was used to test the

effect of supplementing ALA into the birds’ diet. The

statistical significance at p-value < 0.05 between different

supplemented groups was determined based on Duncan’s

test. The results were presented as mean ± SEM. For gene

expression data, differences were considered to be

statistically significant at p-values < 0.05

RESULTS

Growth performance

Statistical analysis of the data represented in Table

(3) revealed that ALA supplementation (group A50, A100,

and A200) significantly (p≤0.05) increase the final body

weight, body weight gain, and average daily gain when

compared with the control group. Also, statistical analysis

of the FCR data indicated that the inclusion rate of ALA

(group A50, A100, and A200) significantly (p≤0.05)

For IGF1R gene expression (Figure 2), ALA

stimulated a dose-dependent increase in IGF1R relative

gene expression level. When it was added at 50 mg/kg

diet, it induced a non-significant increase (2.03 fold) of

IGF1R expression level. While, duplicating the ALA

supplementing dose into the birds’ diet to 100 and 200

174

J. World Poult. Res., 10(2S): 172-179, 2020

mg/kg diet caused a distinct upregulation to IGF1R

mg/kg diet resulted in a significant downregulation of

MSTN gene expression level (P<0.001). It only caused

0.06-fold of MSTN mRNA copies. Additionally, birds fed

ALA at 200 mg/kg diet showed a distinct reduction of

MSTN expression level compared to those fed only basal

diet without ALA supplementation (P<0.001). In

summary, ALA dietary provision upregulated the gene

expression levels of IGF1R and GHR genes and

downregulated the MSTN mRNA level.

mRNA expression level (P=0.009 and P=0.013,

respectively). It stimulated 3.58- and 3.74-fold increases

of IGF1R, respectively. The MSTN mRNA copies were

also modulated following ALA dietary provision (Figure

3). Its supplementation at 50 mg/kg diet significantly

decreased the relative MSTN mRNA level (P<0.001). It

resulted in 0.1-fold compared to the non-supplemented

group (C). Also, ALA addition into birds’ diet at 100

Table 2. Primer sequences used in qPCR analysis

Primer

Sequence

Forward- 5' TACCTGAGCGCAAGTACTCTGCT 3'

Reverse- 5' CATCGTACTCCTGCTTGCTGAT 3'

Forward -5'GATCGGGCTTCACAACTT 3'

Reverse -5'CCTTCGGAGGCTTATTTC 3'

Forward or-5'GCAAAAGCTAGCAGTCTATG 3'

Reverse -5' TCCGTCTTTTTCAGCGTTCT3'

Forward - 5' AACACAGATACCCAACAGCC 3'

Reverse - 5' AGAAGTCAGTGTTTGTCAGGG 3'

Reference

(El-Kassas et al., 2018)

β-actin

IGF1R

MSTN

GHR

(Chen et al., 2011)

(Dushyanth et al., 2016)

(Kamel et al., 2016)

IGF1R: Receptor of insulin like growth factor 1, MSTN: Myostatin, GHR: growth hormone receptor.

Table 3. Effect of dietary ALA on growth performance of broiler chickens.

Item

Control

A50

A100

A200

Initial weight (g)

Final weight (g)

Body weight gain (g)

Average daily gain (g)

Feed intake (g)

51.79±0.56

1706.8±17.2 ^b

1655.0±16.1 ^b

47.29±0.46 ^b

2961.8±6.1

1.79±0.07 ^b

52.06±0.63

1753.2±14.0 ^a

1701.1±13.2 ^a

48.6±0.38 ^a

2975.4±7.5

1.75 ±.09 ^a

51.49±0.69

1768.6±14.8 ^a

1717.1±13.3 ^a

49.06±0.38 ^a

3002.4±9.2

51.62±0.57

1754.8±11.8 ^a

1703.2±10.5 ^a

48.66±0.30 ^a

2969.2±6.3

Feed conversion ratio

1.75±0.05 ^a

1.74±0.03 ^a

ALA: alpha-lipoic acid. Control group received 0 mg ALA/kg diet, A50 group received 50mg ALA/kg diet, A100 group received 100mg ALA/kg diet, and

A200 group received 200mg ALA/kg diet. Values are expressed as mean ± standard errors. Means with different superscript letters within the same row

indicates significant difference at (p ≤ 0.05).

Table 4. Serum liver function of broiler chicken supplemented with ALA at 35 days.

Parameters

Control

A50

7 ±0.577^b

A100

A200

ALT (u/l)

AST (u/l)

AKP (Iu/l)

Total protein (g/dl)

Albumin (g/dl)

Globulin (g/dl)

9.2± 0.416^a

185.2 ± 0.723^a

17.333 ±0.881^a

2.95 ± 0.029^c

1.33 ± 0.020^c

1.617 ± 0.009^d

6.667± 0.330^b

181.667 ± 0.882^b

11.667 ±0.330^bc

3.800 ± 0.057^b

1.510 ± 0.015^c

2.290 ±0.043^b

6.666± 0.882^b

179.704 ± 0.788^b

11.000 ±0.577^c

4.125 ± 0.020^a

1.653 ± 0.044^a

2.492 ±0.020^a

182.1± 0.493^b

13.323 ±0.89^b

3.700 ± 0.058^b

1.62 ± 0.017^b

2.080 ± 0.040^c

ALA: alpha-lipoic acid. ALT: alanine aminotransferase, AST: aspartate aminotransferase, AKP: alkaline phosphatase. Control group received 0 mg ALA/kg

diet, A50 group received 50mg ALA/kg diet, A100 group received 100mg ALA/kg diet, and A200 group received 200mg ALA/kg diet. Values are expressed

as mean ± standard errors. Means with different superscript letters within the same row indicates significant difference at (p ≤ 0.05).

Table 5. Tibia bone composition of broiler chickens supplemented with ALA at 35 days.

Parameters

Dry matter %

Moisture %

Ash %

Ca %

P %

Control

A50

A100

A200

40.98±0.05 ^b

59.02±.0.09 ^a

41.36±0.14 ^b

34.04±1.84 ^b

16.25±1.95

45.21±0.33 ^a

54.79±0.67 ^b

45.63±0.71 ^a

37.32±0.33 ^ab

18.7±1.92

44.10±0.33 ^a

55.90±0.11 ^b

44.5±0.25 ^a

39.0±1.18 ^a

17.68±1.79

44.0±0.19 ^a

56.0±0. 45 ^b

44.41±0.39 ^a

37.7±1.25 ^ab

19.38±1.37

ALA: alpha-lipoic acid. Control group received 0 mg ALA/kg diet, A50 group received 50mg ALA/kg diet, A100 group received 100mg ALA/kg diet, and

A200 group received 200mg ALA/kg diet. Values are expressed as mean ± standard errors. Means with different superscript letters within the same row

indicates significant difference at (p ≤ 0.05).

175

Sakr et al., 2020

DISCUSSION

Growth performance parameters significantly improved

with dietary supplementation of ALA. These results may

be attributed to the ability of the ALA to regulate energy

metabolism where it is an integral component of

mitochondria (Bai et al., 2012 ). Also, it has an antioxidant

effect and acts as a coenzyme in carbohydrate metabolism

in broilers (Packer et al., 2001 ). These results are

consistent with findings of Guo et al. (2014) and Yoo et al.

(2016) who reported improvement of birds’ growth

following ALA supplementation. Also, Lu et al. (2017)

reported that ALA supplementation to broilers under

ammonia stress could relieve stress status and restore

production performance to normal levels. On the other

hand, El-Senousey et al. (2013) and Zhang et al. (2014)

reported that the supplementation of ALA to broiler’s diet

can lower weight gain and feed intake.

A 5 0

A 1 0 0

A 2 0 0

Figure 1. Relative mRNA expression level of GHR (fold

change).C group received mg alpha-lipoic acid

(ALA)/kg diet, A50 group received 50mg ALA/kg diet,

A100 group received 100mg ALA/kg diet, and A200

group received 200mg ALA/kg diet.

To deeply understand the mechanistic regulation of

ALA to birds’ growth, the relative mRNA levels of

growth-regulating genes of GHR, IGF1R, and MSTN were

measured for the first time in muscle tissues. Dietary

supplementation of ALA significantly up-regulated the

gene expression level of GHR, and IGF1R, while

downregulated the mRNA level of MSTN. Modulating the

expression level of these genes might explain the

improved effect of the ALA on the birds’ growth

performance. Since, higher growth performance is

positively correlated with higher levels of growth hormone

and IGF1 (Wen et al., 2014 ). Thus, the upregulations of

the gene expression level of IGF1R and GHR perhaps are

a good confirmation of the improving effect of the ALA to

birds’ growth. Where, IGF-1 stimulates the birds’ growth

by increasing the rate of protein synthesis in the skeletal

muscle (Boschiero et al., 2013). Consequently, the

upregulation of IGF1R and GHR is often positively

correlated with the increase in body weight following the

ALA dietary supplementation. This effect might be

explained by the increased levels of total protein, albumin,

and globulin levels. On the other hand, ALA

downregulated the MSTN gene expression level which

probably is associated with the improved effects on

growth performance. The myostatin which belongs to the

transforming growth factor β (TGF-β) superfamily is a

powerful negative regulator of muscle growth and

differentiation (Jia et al., 2016). Thus, the higher

expression of MSTN reduces the muscle fibers growth by

downregulating myogenic differentiation factor (MyoD)

and myogenic factor (Myf) expression level. Therefore,

A 5 0

A 1 0 0

A 2 0 0

Figure 2. Relative mRNA expression level of IGFR (fold

change). C group received 0 mg alpha-lipoic acid

(ALA)/kg diet, A50 group received 50mg ALA/kg diet,

A100 group received 100mg ALA/kg diet, and A200

group received 200mg ALA/kg diet.

1 .5

1 .0

0 .5

0 .0

A 5 0

A 1 0 0

A 2 0 0

Figure 3. Relative mRNA expression level of MSTN (fold

change). C group received 0 mg alpha-lipoic acid

(ALA)/kg diet, A50 group received 50mg ALA/kg diet,

A100 group received 100mg ALA/kg diet, and A200

group received 200mg ALA/kg diet.

176

J. World Poult. Res., 10(2S): 172-179, 2020

the reduction of MSTN expression level following ALA

dietary provision can explain the improving effect on

growth performance.

best dose of ALA in the diets of broiler chickens

increasing bone efficiency was 100 mg/ kg diet. Is there a

direct relation between ALA and calcium deposition in

bone? A question needs further investigation. More

certainly, groups fed lipoic acid had significantly lower

serum alkaline phosphatase activity than the control group.

Decreasing the level of serum alkaline phosphatase

activity reduced bone abnormalities and increased bone

breaking strength (Ebrahimzadeh et al., 2013). From the

literature, this study was the first one investigating the

effect of dietary ALA supplementation on bone

mineralization of broiler chickens.

In general, biochemical constituents of the serum

reflect the health, nutrition, climate, and management

conditions to which the animals are submitted (Minafra et

al., 2010). The levels of biochemical parameters in the

serum can be used as an indication of the productive

performance of the birds and of metabolic diseases

(Rotava et al., 2008 ). The liver injury could increase the

concentrations of many serum enzymes such as AKP,

AST, and ALT (Shanmugarajan et al., 2008) and decrease

the concentration of total plasma proteins, as the liver is

the organ that synthesizes proteins, especially albumin

(Schmidt et al., 2007 ). In the present study, the result of

biochemical parameters significantly improved at the

different inclusion rates of ALA compared to the control

group. This present finding is strongly supported by the

work of Li et al. (2014). Disagree with the finding of Kim

et al. (2015) who reported that the level and source of

ALA didn't affect total protein, albumin, and globulin but

decreased the liver enzymes in the serum. The results of

this trial may be attributed to the role of ALA as a

biological thiol antioxidant (Ahmad et al., 2018 ).

Normally, free radicals produced in the body under normal

physiological conditions and removed by antioxidants.

The balance between antioxidant and free radicals

negatively affected by sub-optimal diets and poor nutrient

intakes or positively affected by dietary supplementation

(Surai, 2007 ). Based on the result of liver function-related

parameters it can be concluded that ALA supplemented in

the diet at these levels has no bad effect on broilers.

CONCLUSION

In conclusion, ALA-supplemented diet resulted in

significant improvements in the growth performance

through regulating the liver functions, as well as growth-

regulating genes and bone efficiency in broilers.

DECLARATIONS

Authors’ contribution

Osama A. Sakr and Eldsoky Nassef prepared diet

formula and measured growth parameters. Sabreen Ezzat

Fadl measured serum biochemistry and made

interpretation of the results. Seham El-Kassas measured

gene expression and made interpretation of the results.

Hazem Omar and Emad Waded helped in the measuring of

serum biochemistry.

Conflicting interests

The results of the present study showed the

beneficial effect of ALA on bone efficiency as indicated

by increasing ash and calcium contents in tibia bone. It is

well known that there is a direct relationship between liver

and kidney functions and bone efficiency through

activation of vitamin D by hydroxylation (Koreleski and

Swiatkiewicz, 2005). In the present study, ALA improved

liver function as indicated by the reduction of serum ALT

and AST enzymes. On the other hand, reactive oxygen

species such as hydrogen peroxides, the hydroxyl group,

and superoxide interact with nucleic acid altering cellular

metabolism leading to oxidation of hepatocytes or

accumulation of fat (Karaman et al., 2010 ), where

activation of vitamin D takes place. ALA acts as an

antioxidant that protects hepatocytes and renal cells

against oxidative stress (Guo et al., 2014). This function

was reflected in increasing calcium deposition in bone,

subsequently increasing ash content and bone density. The

No conflict of interest

REFERENCES

Ahmad SB, Ahmad I, Ahmad N, Qureshi ZI, Jamil H, Ali Q and

Ashfaq

K (2018). effect of addition of different

concentrations of alpha lipoic acid to tris egg yolk citrate

glycerol extender on cryopreservation of sahiwal bull

spermatozoa. Pakistan Veterinary Journal, 38(3): 301-305.

DOI: http://dx.doi.org/10.29261/pakvetj/2018.060.

AOAC. Association of Official Analytical Chemists (2019).

Official Method of Analysis. 18th ed. AOAC,

Gaithersburg,

MD.

Available

at:

https://www.aoac.org/official-methods-of-analysis-21st-

edition-2019/

Bai SW, Chen CY, Ji J, Xie QM, Ma Y, Sun BL, Xue CY, Cao

YC, Ma JY and Bi YZ (2012). Inhibition effect of alpha-

lipoic acid on the propagation of influenza A virus in

MDCK cells. Pakistan Veterinary Journal, 32(1): 101-106.

Available at: www.pvj.com.pk.

177

Sakr et al., 2020

Boschiero C, Jorge EC, Ninov K, Nones K, do Rosário MF,

investigations on the protective effect of α-lipoic acid in

Coutinho LL, Ledur MC, Burt DW and Moura AS (2013).

Association of IGF1 and KDM5A polymorphisms with

performance, fatness and carcass traits in chickens. Journal

experimental aflatoxin toxicosis in chicks. British Poultry

Science,

51(1):132-41.

DOI:

https://doi.org/10.1080/00071660903401839

Applied

Genetics,

54(1):103-12.

DOI:

Kim DW, Mushtaq MM, Parvin R, Kang HK, Kim JH, Na JC,

Hwangbo J, Kim JD, Yang CB, Park BJ and Choi HC

(2015). Various levels and forms of dietary α-lipoic acid in

broiler chickens: Impact on blood biochemistry, stress

response, liver enzymes, and antibody titers. Poultry

https://doi.org/10.1007/s13353-012-0129-6.

Chen J, Wang M, Kong Y, Ma H, and Zou S (2011). Comparison

of the novel compounds creatine and pyruvate on lipid and

protein metabolism in broiler chickens. Animal, 5 (7):

1082-1089.

‏

DOI:

Science,

94(2):226-31.

DOI:

https://doi.org/10.1017/s1751731111000085

https://doi.org/10.3382/ps/peu056

Dushyanth K, Bhattacharya TK, Shukla R, Chatterjee RN,

Sitaramamma T, Paswan C and Guru Vishnu P (2016).

Gene expression and polymorphism of myostatin gene and

its association with growth traits in chicken. Animal

Kofuji K, Nakamura M, Isobe T, Murata Y and Kawashima S

(2008). Stabilization of α-lipoic acid by complex formation

with chitosan. Food Chemistry, 109(1):167-71. DOI:

https://doi.org/10.1016/j.foodchem.2007.11.078

Biotechnology,

https://doi.org/10.1080/10495398.2016.1182541

27(4):269-77.

DOI:

Koreleski J and Świątkiewicz S (2005). Efficacy of different

levels of a cholecalciferol 25-OH-derivative in diets with

two limestone forms in laying hen nutrition. Journal of

Animal Feed Science, 14(2): 305-315.

‏

DOI:

https://doi.org/10.22358/jafs/67018/2005

Ebrahimzadeh S, Farhoomand P and Noori K (2013). Effects of

chromium methionine supplementation on performance,

carcass traits, and the Ca and P metabolism of broiler

chickens under heat-stress conditions. Journal of Applied

Li Y, Ma QG, Zhao LH, Guo YQ, Duan GX, Zhang JY and Ji C

(2014). Protective efficacy of alpha-lipoic acid against

aflatoxinB1-induced oxidative damage in the liver. Asian-

Australasian Journal of Animal Sciences, 27(6):907. DOI:

https://doi.org/10.5713/ajas.2013.13588Livak KJ and

Schmittgen TD (2001). Analysis of Relative gene

expression data using real-time quantitative PCR and the

2-∆∆CT method. Methods, 25, 402–408. DOI:

https://doi.org/10.1006/meth.2001.1262

Poultry

Research,

22:

382-387.

DOI:

https://doi.org/10.3382/japr.2011-00506

El-Kassas S, Abdo SE, El-Naggar K, Abdo W, Kirrella AA and

Nashar TO (2018). Ameliorative effect of dietary

supplementation of copper oxide nanoparticles on

inflammatory and immune responses in commercial broiler

under normal and heat-stress housing conditions. Journal

Thermal

Biology,

78:235-46.

DOI:

https://doi.org/10.1016/j.jtherbio.2018.10.009

Lu M, Bai J, Wei F, Xu B, Sun Q, Li J, Wang G, Tang X, Zhang

H, Yin Q and Li S (2017). Effects of alpha‐lipoic acid

supplementation on growth performance, antioxidant

capacity and biochemical parameters for ammonia‐exposed

broilers. Animal Science Journal, 88(8):1220-5. DOI:

https://doi.org/10.1111/asj.12759

El-Kassas S, Odemuyiwa S, Hajishengallis G, Connell TD and

Nashar TO (2016). Expression and regulation of

cholecystokinin receptor in the chicken's immune organs

and cells. Journal of Clinical and Cellular Immunology,

7(6):

471.

DOI:

https://doi.org/

10.4172/2155-

9899.1000471

Minafra CS, Marques SF, Stringhini JH, Ulhoa CJ, Rezende CS,

Santos JS and Moraes GH (2010). Perfil bioquímico do

soro de frangos de corte alimentados com dieta

suplementada com alfa-amilase de Cryptococcus flavus e

Aspergillus niger HM2003. Revista Brasileira de

El-Senousey HK, Fouad AM, Yao JH, Zhang ZG and Shen QW

(2013). Dietary alpha lipoic acid improves body

composition, meat quality and decreases collagen content

in muscle of broiler chickens. Asian-Australasian Journal

Animal

Sciences,

26(3):394.

DOI:

Zootecnia,

39(12):2691-2696.

DOI:

10.5713/ajas.2012.12430

http://dx.doi.org/10.1590/S1516-35982010001200020

Guo ZY, Li JL, Zhang L, Jiang Y, Gao F and Zhou GH (2014).

Effects of alpha-lipoic acid supplementation in different

stages on growth performance, antioxidant capacity and

meat quality in broiler chickens. British Poultry Science,

Packer L, Witt EH and Tritschler HJ (1995). Alpha-lipoic acid as

biological antioxidant. Free Radical Biology and

Medicine, 19:227-250. DOI: https://doi.org/10.1016/0891-

5849(95)00017-R

55(5):635-43.

https://doi.org/10.1080/00071668.2014.958057

DOI:

Packer L, Kraemer K and Rimbach G (2001). Molecular aspects

of lipoic acid in the prevention of diabetes

Jia Y, Gao G, Song H, Cai D, Yang X and Zhao R (2016). Low-

protein diet fed to crossbred sows during pregnancy and

lactation enhances myostatin gene expression through

epigenetic regulation in skeletal muscle of weaning piglets.

European Journal of Nutrition, 55(3):1307-14. DOI:

https://doi.org/10.1007/s00394-015-0949-3

complications. Nutrition, 17: 888–895.

https://doi.org/10.1016/S0899-9007(01)00658-X

DOI:

Petracci M and Cavani C, 2012. Muscle growth and poultry meat

quality issues. Nutrition, 4(1): 1-12. DOI:

https://doi.org/10.3390/nu4010001

Rotava R, Zanella I, Karkow AK, Dullius AP, da da Silva LP and

Denardin CC (2008). Bioquímica sanguínea de frangos de

corte alimentados com subprodutos da uva. Agrarian,

1(1):91-104. Available at: http://www.uvibra.com.br/

pdf/safra_uva1998-2007.pdf.

Kamel ER, Manaa E and Farid AS (2016). The effects of dietary

date pit on the productive and economic efficiency of

Japanese quail. Alexandria Journal of Veterinary Science,

51(2):211-222. DOI: https://doi.org/10.5455/ajvs.233838

Karaman M, Özen H, Tuzcu M, Ciğremiş Y, Önder F and Özcan

K (2010). Pathological, biochemical and haematological

178

J. World Poult. Res., 10(2S): 172-179, 2020

Schmidt EMS, Locatelli-Dittrich R, Santin E and Paulillo AC

(2007). Patologia clínica em aves de produção–uma

ferramenta para monitorar sanidade avícola–

Wen C, Wu P, Chen Y, Wang T and Zhou Y (2014). Methionine

improves the performance and breast muscle growth of

broilers with lower hatching weight by altering the

expression of genes associated with the insulin-like growth

factor-I signaling pathway. British Journal of Nutrition,

revisão. Archive of Veterinary Science, 12(3).

‏

DOI:

https://doi.org/10.5380/avs.v12i3.10906

111(2):201-6.

https://doi.org/10.1017/S0007114513002419

DOI:

Shanmugarajan TS, Sivaraman D, Somasundaram I, Arunsundar

M, Krishnakumar E, Balaji R and Ravichandiran V (2008).

Influence of alpha lipoic acid on antioxidant status in D-

galactosamine-induced hepatic injury. Toxicology and

Yoo J, Yi YJ, Koo B, Jung S, Yoon JU, Kang HB, Lee DH and

Heo JM (2016). Growth performance, intestinal

morphology, and meat quality in relation to alpha-lipoic

acid associated with vitamin C and E in broiler chickens

under tropical conditions. Revista Brasileira de Zootecnia,

Industrial

Health,

24(10):635-42.

DOI:

https://doi.org/10.1177/0748233708101215

Sohaib M, Anjum FM, Nasir M, Saeed F, Arshad MS and

Hussain S (2018). Alpha‐lipoic acid: An inimitable feed

supplement for poultry nutrition. Journal of Animal

Physiology and Animal Nutrition, 102(1):33-40. DOI:

https://doi.org/10.1111/jpn.12693

45(3):113-20.

92902016000300005

DOI:

http://dx.doi.org/10.1590/S1806-

Zhang Y, Jia R, Ji C, Ma Q, Huang J, Yin H and Liu L (2014).

Effects of dietary alpha-lipoic acid and acetyl-L-carnitine

on growth performance and meat quality in Arbor Acres

broilers. Asian-Australasian Journal of Animal Sciences,

27(7):996. DOI: https://doi.org /10.5713/ajas.2013.13436

Surai PF (2007). Natural antioxidants in poultry nutrition: new

developments. In Proceedings of the 16th European

symposium on poultry nutrition (pp. 26-30). World Poultry

Science Association.

179